PRKACB cDNA ORF Clone, Human, N-HA tag

Cat: HG12272-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRKACB Reagents
CRO Services
Product recommended

All PRKACB Reagents
PRKACB cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
774 bp
Description
Full length Clone DNA of Human protein kinase, cAMP-dependent, catalytic, beta with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKACB cDNA ORF Clone, Human, N-HA tag Alternative Names
PKAC-beta cDNA ORF Clone, Human;PKACB cDNA ORF Clone, Human
PRKACB Background Information
Full Name
protein kinase, cAMP-dependent, catalytic, beta

PRKACB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKACB cDNA ORF Clone in Cloning Vector, Mouse MG50629-M
PRKACB cDNA ORF Clone, Mouse, untagged MG50629-UT
PRKACB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50629-ACGLN
PRKACB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50629-ACG
PRKACB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50629-ANG
PRKACB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50629-ACR
PRKACB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50629-ANR
PRKACB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50629-CF
PRKACB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50629-NF
PRKACB cDNA ORF Clone, Mouse, C-His tag MG50629-CH
PRKACB cDNA ORF Clone, Mouse, N-His tag MG50629-NH
PRKACB cDNA ORF Clone, Mouse, C-HA tag MG50629-CY
PRKACB cDNA ORF Clone, Mouse, N-HA tag MG50629-NY
PRKACB cDNA ORF Clone, Mouse, C-Myc tag MG50629-CM
PRKACB cDNA ORF Clone, Mouse, N-Myc tag MG50629-NM
PRKACB qPCR Primer Pairs, Mouse MP200368

PRKACB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKACB cDNA ORF Clone in Cloning Vector, Human HG12272-G
PRKACB cDNA ORF Clone, Human, untagged HG12272-UT
PRKACB cDNA ORF Clone, Human, C-GFPSpark® tag HG12272-ACG
PRKACB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12272-ACGLN
PRKACB cDNA ORF Clone, Human, N-GFPSpark® tag HG12272-ANG
PRKACB cDNA ORF Clone, Human, C-OFPSpark® tag HG12272-ACR
PRKACB cDNA ORF Clone, Human, N-OFPSpark® tag HG12272-ANR
PRKACB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12272-CF
PRKACB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12272-NF
PRKACB cDNA ORF Clone, Human, C-His tag HG12272-CH
PRKACB cDNA ORF Clone, Human, N-His tag HG12272-NH
PRKACB cDNA ORF Clone, Human, C-HA tag HG12272-CY
PRKACB cDNA ORF Clone, Human, C-Myc tag HG12272-CM
PRKACB cDNA ORF Clone, Human, N-Myc tag HG12272-NM
PRKACB qPCR Primer Pairs, Human HP101883
info info
添加购物车成功! 添加购物车失败!