Quick Order

Human PRKAB2 Gene ORF cDNA clone expression plasmid

  • Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PRKAB2 cDNA Clone Product Information
NCBI RefSeq:NM_005399
RefSeq ORF Size:819bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase, AMP-activated, beta 2 non-catalytic subunit.
Gene Synonym:MGC61468, PRKAB2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PRKAB2
Restriction Site:KpnI + XbaI (6.1kb + 0.82kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PRKAB2 qPCR primers for gene expression analysis, HP101568 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRKAB2 Gene Plasmid Map
Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG12032-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"