Peroxiredoxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11257-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Peroxiredoxin 6 Reagents
CRO Services
Product recommended

All Peroxiredoxin 6 Reagents
Peroxiredoxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
714 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peroxiredoxin 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Peroxiredoxin 6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Peroxiredoxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human Peroxiredoxin 6/PRDX6 Gene Expression validated Image 16509
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Peroxiredoxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
1-Cys cDNA ORF Clone, Human;aiPLA2 cDNA ORF Clone, Human;AOP2 cDNA ORF Clone, Human;HEL-S-128m cDNA ORF Clone, Human;NSGPx cDNA ORF Clone, Human;p29 cDNA ORF Clone, Human;PRX cDNA ORF Clone, Human
Peroxiredoxin 6 Background Information
Full Name
peroxiredoxin 6

Peroxiredoxin 6 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Ferret FG60124-G
Peroxiredoxin 6 cDNA ORF Clone, Ferret, untagged FG60124-UT
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60124-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60124-ACG
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60124-ANG
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60124-ACR
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60124-ANR
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60124-CF
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60124-NF
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-His tag FG60124-CH
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-His tag FG60124-NH
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-HA tag FG60124-CY
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-HA tag FG60124-NY
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-Myc tag FG60124-CM
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-Myc tag FG60124-NM

Peroxiredoxin 6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Rat RG82760-U
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82760-ACGLN

Peroxiredoxin 6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Mouse MG51391-G
Peroxiredoxin 6 cDNA ORF Clone, Mouse, untagged MG51391-UT
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51391-ACG
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51391-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51391-ANG
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51391-ACR
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51391-ANR
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51391-CF
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51391-NF
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-His tag MG51391-CH
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag MG51391-NH
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-HA tag MG51391-CY
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-HA tag MG51391-NY
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-Myc tag MG51391-CM
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-Myc tag MG51391-NM
Peroxiredoxin 6 qPCR Primer Pairs, Mouse MP201282

Peroxiredoxin 6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Human HG11257-M
Peroxiredoxin 6 cDNA ORF Clone, Human, untagged HG11257-UT
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11257-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11257-ACG
Peroxiredoxin 6 cDNA ORF Clone, Human, N-GFPSpark® tag HG11257-ANG
Peroxiredoxin 6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11257-ACR
Peroxiredoxin 6 cDNA ORF Clone, Human, N-OFPSpark® tag HG11257-ANR
Peroxiredoxin 6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11257-CF
Peroxiredoxin 6 cDNA ORF Clone, Human, C-His tag HG11257-CH
Peroxiredoxin 6 cDNA ORF Clone, Human, N-His tag HG11257-NH
Peroxiredoxin 6 cDNA ORF Clone, Human, C-HA tag HG11257-CY
Peroxiredoxin 6 cDNA ORF Clone, Human, N-HA tag HG11257-NY
Peroxiredoxin 6 cDNA ORF Clone, Human, C-Myc tag HG11257-CM
Peroxiredoxin 6 cDNA ORF Clone, Human, N-Myc tag HG11257-NM
Peroxiredoxin 6 qPCR Primer Pairs, Human HP101141
info info
添加购物车成功! 添加购物车失败!