Peroxiredoxin 5 cDNA ORF Clone, Human, C-His tag

Cat: HG11263-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Peroxiredoxin 5 Reagents
CRO Services
Product recommended

All Peroxiredoxin 5 Reagents
Peroxiredoxin 5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
645 bp
Description
Full length Clone DNA of Human peroxiredoxin 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Peroxiredoxin 5 cDNA ORF Clone, Human, C-His tag Alternative Names
ACR1 cDNA ORF Clone, Human;AOEB166 cDNA ORF Clone, Human;B166 cDNA ORF Clone, Human;HEL-S-55 cDNA ORF Clone, Human;PLP cDNA ORF Clone, Human;PMP20 cDNA ORF Clone, Human;PRDX6 cDNA ORF Clone, Human;prx-V cDNA ORF Clone, Human;PRXV cDNA ORF Clone, Human;SBBI10 cDNA ORF Clone, Human
Peroxiredoxin 5 Background Information

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

Full Name
peroxiredoxin 5
References
  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Peroxiredoxin 5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 5 cDNA ORF Clone in Cloning Vector, Mouse MG50551-M
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, untagged MG50551-UT
    Peroxiredoxin 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50551-ACGLN
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50551-ACG
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50551-ANG
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50551-ACR
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50551-ANR
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50551-CF
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50551-NF
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-His tag MG50551-CH
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-His tag MG50551-NH
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-HA tag MG50551-CY
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-HA tag MG50551-NY
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, C-Myc tag MG50551-CM
    Peroxiredoxin 5 cDNA ORF Clone, Mouse, N-Myc tag MG50551-NM
    Peroxiredoxin 5 qPCR Primer Pairs, Mouse MP200543

    Peroxiredoxin 5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 5 cDNA ORF Clone in Cloning Vector, Human HG11263-G
    Peroxiredoxin 5 cDNA ORF Clone, Human, untagged HG11263-UT
    Peroxiredoxin 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11263-ACGLN
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11263-ACG
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-GFPSpark® tag HG11263-ANG
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11263-ACR
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-OFPSpark® tag HG11263-ANR
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11263-G-F
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11263-CF
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11263-NF
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-His tag HG11263-NH
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-HA tag HG11263-CY
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-HA tag HG11263-NY
    Peroxiredoxin 5 cDNA ORF Clone, Human, C-Myc tag HG11263-CM
    Peroxiredoxin 5 cDNA ORF Clone, Human, N-Myc tag HG11263-NM
    Peroxiredoxin 5 qPCR Primer Pairs, Human HP101147
    info info
    添加购物车成功! 添加购物车失败!