PRDX4 cDNA ORF Clone, Human, N-HA tag

Cat: HG12197-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRDX4 Reagents
CRO Services
Product recommended

All PRDX4 Reagents
PRDX4 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Human peroxiredoxin 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRDX4 cDNA ORF Clone, Human, N-HA tag Alternative Names
AOE37-2 cDNA ORF Clone, Human;AOE372 cDNA ORF Clone, Human;HEL-S-97n cDNA ORF Clone, Human;PRX-4 cDNA ORF Clone, Human
PRDX4 Background Information
Full Name
peroxiredoxin 4

PRDX4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRDX4 cDNA ORF Clone in Cloning Vector, Rat RG85653-U
PRDX4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85653-ACGLN

PRDX4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRDX4 cDNA ORF Clone in Cloning Vector, Mouse MG53201-U
PRDX4 cDNA ORF Clone, Mouse, untagged MG53201-UT
PRDX4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53201-ACGLN
PRDX4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53201-ACG
PRDX4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53201-ANG
PRDX4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53201-ACR
PRDX4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53201-ANR
PRDX4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53201-CF
PRDX4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53201-NF
PRDX4 cDNA ORF Clone, Mouse, C-His tag MG53201-CH
PRDX4 cDNA ORF Clone, Mouse, N-His tag MG53201-NH
PRDX4 cDNA ORF Clone, Mouse, C-HA tag MG53201-CY
PRDX4 cDNA ORF Clone, Mouse, N-HA tag MG53201-NY
PRDX4 cDNA ORF Clone, Mouse, C-Myc tag MG53201-CM
PRDX4 cDNA ORF Clone, Mouse, N-Myc tag MG53201-NM

PRDX4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRDX4 cDNA ORF Clone in Cloning Vector, Human HG12197-G
PRDX4 cDNA ORF Clone, Human, untagged HG12197-UT
PRDX4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12197-ACGLN
PRDX4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12197-ACG
PRDX4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12197-ACR
PRDX4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12197-CF
PRDX4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12197-NF
PRDX4 cDNA ORF Clone, Human, C-His tag HG12197-CH
PRDX4 cDNA ORF Clone, Human, N-His tag HG12197-NH
PRDX4 cDNA ORF Clone, Human, C-HA tag HG12197-CY
PRDX4 cDNA ORF Clone, Human, C-Myc tag HG12197-CM
PRDX4 cDNA ORF Clone, Human, N-Myc tag HG12197-NM
PRDX4 qPCR Primer Pairs, Human HP101825
info info
添加购物车成功! 添加购物车失败!