After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRDM2 / RIZ1 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PRDM2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1514bp
cDNA Description:Full length Clone DNA of Homo sapiens PR domain containing 2, with ZNF domain with C terminal HA tag.
Gene Synonym:RIZ, KMT8, RIZ1, RIZ2, MTB-ZF, HUMHOXY1, PRDM2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PR domain containing 2, with ZNF domain (PRDM2), also known as zinc finger protein RIZ, is a member of histone methyltransferase (HMT) class enzymes that methylate lysine residues of histones or proteins. HMTs contain a conserved catalytic core termed the SET domain, which shares sequence homology with an independently described sequence motif, the PR domain. PRDM2 contains 8 C2H2-type zinc fingers and a distinct SET domain, and is highly expressed in retinoblastoma cell lines and in brain tumors, as well as in a number of other cell lines and in brain, heart, skeletal muscle, liver and spleen. PRDM2 is a S-adenosyl-L-methionine-dependent histone methyltransferase that specifically methylates 'Lys-9' of histone H3, and is identified as a tumor suppressor. It is reported that intact PR( SET) sequence is required for tumor suppression functions, mutations in the PR domain caused activity reduction in human cancers. Also, S-adenosylhomocysteine or methyl donor deficiency inhibits RIZ1 and other H3 lysine 9 methylation activities. PRDM2 may also function as a DNA-binding transcription factor. It Binds to the macrophage-specific TPA-responsive element (MTE) of the HMOX1 (heme oxygenase 1) gene and act as a transcriptional activator. In addition, PRDM2 (RIZ) is able to binds to the retinoblastoma protein (RB) and also Interacts with GATA3.

References
  • Buyes, I.M. et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92: 4467-4471.
  • Muraosa, Y. et al., 1996, Eur. J. Biochem. 235: 471-479.
  • Kim, K. et al., 2003, Cancer. Res. 63: 7619-7623.
  • Shapiro, V.S. et al., 1995, Gene. 163: 329-330.
  • Briknarova, K.et al.,2008,Biochem.Biophys.Res.Commun.366:807-813.
  • Size / Price
    Catalog: HG11216-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"