Quick Order

Text Size:AAA

Human PRC1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PRC1 cDNA Clone Product Information
NCBI RefSeq:BC003138
RefSeq ORF Size:1863bp
cDNA Description:Full length Clone DNA of Homo sapiens protein regulator of cytokinesis 1.
Gene Synonym:ASE1, PRC1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PRC1 qPCR primers for gene expression analysis, HP101988 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis. It interacts with KIF14, IF20A and PLK1.

References
  • Jiang W, et al. (1999) PRC1: a human mitotic spindle-associated CDK substrate protein required for cytokinesis. Mol Cell. 2(6):877-85.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):173-8.
  • Mollinari C, et al. (2002) PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol. 15 (7):1175-86.
  • Size / Price
    Catalog: HG13280-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"