PRAME cDNA ORF Clone, Human, N-His tag

Cat: HG14877-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRAME Reagents
CRO Services
Product recommended

All PRAME Reagents
PRAME cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1575 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human preferentially expressed antigen in melanoma with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI(6kb+1.58kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PRAME cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRAME cDNA ORF Clone, Human, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
PRAME cDNA ORF Clone, Human, N-His tag Alternative Names
CT130 cDNA ORF Clone, Human;MAPE cDNA ORF Clone, Human;OIP-4 cDNA ORF Clone, Human;OIP4 cDNA ORF Clone, Human
PRAME Background Information

PRAME gene encodes an antigen that is preferentially expressed in human melanomas and that is recognized by cytolytic T lymphocytes. It is not expressed in normal tissues, except testis. The encoded protein acts as a repressor of retinoic acid receptor, and likely confers a growth advantage to cancer cells via this function. Alternative splicing results in multiple transcript variants. PRAME is also emerging as an important component of the retinol pathway, which is known to regulate various aspects of cell proliferation, differentiation, apoptosis and vertebrate development. It has been suggested that PRAME contributes to cancer development and progression by interfering with the metabolic pathway of all-trans retinol (vitamin A) and its active metabolites, retinal, β-carotene, all-trans retinoic acid (ATRA), and 9-cis and 13-cis retinoic acids, collectively known as retinoids.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
preferentially expressed antigen in melanoma
References
  • Szczepanski MJ, Whiteside TL. Elevated PRAME expression: what does this mean for treatment of head and neck squamous cell carcinoma? Biomarkers in medicine. 2013;7(4):575-578.
  • info info
    添加购物车成功! 添加购物车失败!