PPTC7 cDNA ORF Clone, Human, N-His tag

Cat: HG13800-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPTC7 Reagents
CRO Services
Product recommended

All PPTC7 Reagents
PPTC7 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
915 bp
Description
Full length Clone DNA of Human PTC7 protein phosphatase homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPTC7 cDNA ORF Clone, Human, N-His tag Alternative Names
TA-PP2C cDNA ORF Clone, Human;TAPP2C cDNA ORF Clone, Human
PPTC7 Background Information
Full Name
PTC7 protein phosphatase homolog

PPTC7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPTC7 cDNA ORF Clone in Cloning Vector, Mouse MG5A6146-U
PPTC7 cDNA ORF Clone, Mouse, untagged MG5A6146-UT
PPTC7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6146-ACGLN
PPTC7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6146-ACG
PPTC7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6146-ANG
PPTC7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6146-ACR
PPTC7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6146-ANR
PPTC7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6146-CF
PPTC7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6146-NF
PPTC7 cDNA ORF Clone, Mouse, C-His tag MG5A6146-CH
PPTC7 cDNA ORF Clone, Mouse, N-His tag MG5A6146-NH
PPTC7 cDNA ORF Clone, Mouse, C-HA tag MG5A6146-CY
PPTC7 cDNA ORF Clone, Mouse, N-HA tag MG5A6146-NY
PPTC7 cDNA ORF Clone, Mouse, C-Myc tag MG5A6146-CM
PPTC7 cDNA ORF Clone, Mouse, N-Myc tag MG5A6146-NM

PPTC7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPTC7 cDNA ORF Clone in Cloning Vector, Human HG13800-G
PPTC7 cDNA ORF Clone, Human, untagged HG13800-UT
PPTC7 cDNA ORF Clone, Human, C-GFPSpark® tag HG13800-ACG
PPTC7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13800-ACGLN
PPTC7 cDNA ORF Clone, Human, N-GFPSpark® tag HG13800-ANG
PPTC7 cDNA ORF Clone, Human, C-OFPSpark® tag HG13800-ACR
PPTC7 cDNA ORF Clone, Human, N-OFPSpark® tag HG13800-ANR
PPTC7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13800-CF
PPTC7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13800-NF
PPTC7 cDNA ORF Clone, Human, C-His tag HG13800-CH
PPTC7 cDNA ORF Clone, Human, C-HA tag HG13800-CY
PPTC7 cDNA ORF Clone, Human, N-HA tag HG13800-NY
PPTC7 cDNA ORF Clone, Human, C-Myc tag HG13800-CM
PPTC7 cDNA ORF Clone, Human, N-Myc tag HG13800-NM
PPTC7 qPCR Primer Pairs, Human HP102473
info info
添加购物车成功! 添加购物车失败!