PPT1 cDNA ORF Clone, Human, C-His tag

Cat: HG14703-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PPT1 Reagents
CRO Services
Product recommended

All PPT1 Reagents
PPT1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
921 bp
Description
Full length Clone DNA of Human palmitoyl-protein thioesterase 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPT1 cDNA ORF Clone, Human, C-His tag Alternative Names
CLN1 cDNA ORF Clone, Human;INCL cDNA ORF Clone, Human;PPT cDNA ORF Clone, Human;PPT1 cDNA ORF Clone, Human
PPT1 Background Information
Full Name
palmitoyl-protein thioesterase 1

PPT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PPT1 cDNA ORF Clone in Cloning Vector, Rat RG84025-U
PPT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84025-ACGLN

PPT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPT1 cDNA ORF Clone in Cloning Vector, Mouse MG53172-G
PPT1 cDNA ORF Clone, Mouse, untagged MG53172-UT
PPT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53172-ACG
PPT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53172-ACGLN
PPT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53172-ACR
PPT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53172-CF
PPT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53172-NF
PPT1 cDNA ORF Clone, Mouse, C-His tag MG53172-CH
PPT1 cDNA ORF Clone, Mouse, N-His tag MG53172-NH
PPT1 cDNA ORF Clone, Mouse, C-HA tag MG53172-CY
PPT1 cDNA ORF Clone, Mouse, N-HA tag MG53172-NY
PPT1 cDNA ORF Clone, Mouse, C-Myc tag MG53172-CM
PPT1 cDNA ORF Clone, Mouse, N-Myc tag MG53172-NM

PPT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPT1 cDNA ORF Clone in Cloning Vector, Human HG14703-G
PPT1 cDNA ORF Clone, Human, untagged HG14703-UT
PPT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14703-ACGLN
PPT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14703-ACG
PPT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14703-ANG
PPT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14703-ACR
PPT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14703-ANR
PPT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14703-CF
PPT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14703-NF
PPT1 cDNA ORF Clone, Human, N-His tag HG14703-NH
PPT1 cDNA ORF Clone, Human, C-HA tag HG14703-CY
PPT1 cDNA ORF Clone, Human, N-HA tag HG14703-NY
PPT1 cDNA ORF Clone, Human, C-Myc tag HG14703-CM
PPT1 cDNA ORF Clone, Human, N-Myc tag HG14703-NM
PPT1 qPCR Primer Pairs, Human HP103337
info info
添加购物车成功! 添加购物车失败!