PPP5C cDNA ORF Clone, Human, N-Myc tag

Cat: HG13864-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPP5C Reagents
CRO Services
Product recommended

All PPP5C Reagents
PPP5C cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1500 bp
Description
Full length Clone DNA of Human protein phosphatase 5, catalytic subunit with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP5C cDNA ORF Clone, Human, N-Myc tag Alternative Names
PP5 cDNA ORF Clone, Human;PPP5 cDNA ORF Clone, Human;PPT cDNA ORF Clone, Human
PPP5C Background Information
Full Name
protein phosphatase 5, catalytic subunit

PPP5C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP5C cDNA ORF Clone in Cloning Vector, Mouse MG59386-U
PPP5C cDNA ORF Clone, Mouse, untagged MG59386-UT
PPP5C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59386-ACG
PPP5C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59386-ACGLN
PPP5C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59386-ANG
PPP5C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59386-ACR
PPP5C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59386-ANR
PPP5C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59386-CF
PPP5C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59386-NF
PPP5C cDNA ORF Clone, Mouse, C-His tag MG59386-CH
PPP5C cDNA ORF Clone, Mouse, N-His tag MG59386-NH
PPP5C cDNA ORF Clone, Mouse, C-HA tag MG59386-CY
PPP5C cDNA ORF Clone, Mouse, N-HA tag MG59386-NY
PPP5C cDNA ORF Clone, Mouse, C-Myc tag MG59386-CM
PPP5C cDNA ORF Clone, Mouse, N-Myc tag MG59386-NM

PPP5C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP5C cDNA ORF Clone in Cloning Vector, Human HG13864-G
PPP5C cDNA ORF Clone, Human, untagged HG13864-UT
PPP5C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13864-ACGLN
PPP5C cDNA ORF Clone, Human, C-GFPSpark® tag HG13864-ACG
PPP5C cDNA ORF Clone, Human, N-GFPSpark® tag HG13864-ANG
PPP5C cDNA ORF Clone, Human, C-OFPSpark® tag HG13864-ACR
PPP5C cDNA ORF Clone, Human, N-OFPSpark® tag HG13864-ANR
PPP5C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13864-CF
PPP5C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13864-NF
PPP5C cDNA ORF Clone, Human, C-His tag HG13864-CH
PPP5C cDNA ORF Clone, Human, N-His tag HG13864-NH
PPP5C cDNA ORF Clone, Human, C-HA tag HG13864-CY
PPP5C cDNA ORF Clone, Human, N-HA tag HG13864-NY
PPP5C cDNA ORF Clone, Human, C-Myc tag HG13864-CM
PPP5C qPCR Primer Pairs, Human HP102535
info info
添加购物车成功! 添加购物车失败!