Calcineurin A cDNA ORF Clone, Human, C-Myc tag

Cat: HG13669-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Calcineurin A Reagents
CRO Services
Product recommended

All Calcineurin A Reagents
Calcineurin A cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Calcineurin A cDNA ORF Clone, Human, C-Myc tag Alternative Names
CALN cDNA ORF Clone, Human;CALNA cDNA ORF Clone, Human;CALNA1 cDNA ORF Clone, Human;CCN1 cDNA ORF Clone, Human;CNA1 cDNA ORF Clone, Human;PPP2B cDNA ORF Clone, Human
Calcineurin A Background Information

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

Full Name
protein phosphatase 3, catalytic subunit, alpha isozyme
References
  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • Calcineurin A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Calcineurin A cDNA ORF Clone in Cloning Vector, Rat RG82156-U
    Calcineurin A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82156-ACGLN

    Calcineurin A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Calcineurin A cDNA ORF Clone in Cloning Vector, Human HG13669-G
    Calcineurin A cDNA ORF Clone in Cloning Vector, Human HG13670-G
    Calcineurin A cDNA ORF Clone, Human, untagged HG13670-UT
    Calcineurin A cDNA ORF Clone, Human, untagged HG13669-UT
    Calcineurin A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13669-ACGLN
    Calcineurin A cDNA ORF Clone, Human, C-GFPSpark® tag HG13670-ACG
    Calcineurin A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13670-ACGLN
    Calcineurin A cDNA ORF Clone, Human, C-GFPSpark® tag HG13669-ACG
    Calcineurin A cDNA ORF Clone, Human, N-GFPSpark® tag HG13669-ANG
    Calcineurin A cDNA ORF Clone, Human, N-GFPSpark® tag HG13670-ANG
    Calcineurin A cDNA ORF Clone, Human, C-OFPSpark® tag HG13670-ACR
    Calcineurin A cDNA ORF Clone, Human, C-OFPSpark® tag HG13669-ACR
    Calcineurin A cDNA ORF Clone, Human, N-OFPSpark® tag HG13669-ANR
    Calcineurin A cDNA ORF Clone, Human, N-OFPSpark® tag HG13670-ANR
    Calcineurin A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13670-CF
    Calcineurin A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13669-CF
    Calcineurin A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13669-NF
    Calcineurin A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13670-NF
    Calcineurin A cDNA ORF Clone, Human, C-His tag HG13669-CH
    Calcineurin A cDNA ORF Clone, Human, C-His tag HG13670-CH
    Calcineurin A cDNA ORF Clone, Human, N-His tag HG13669-NH
    Calcineurin A cDNA ORF Clone, Human, N-His tag HG13670-NH
    Calcineurin A cDNA ORF Clone, Human, C-HA tag HG13669-CY
    Calcineurin A cDNA ORF Clone, Human, C-HA tag HG13670-CY
    Calcineurin A cDNA ORF Clone, Human, N-HA tag HG13669-NY
    Calcineurin A cDNA ORF Clone, Human, N-HA tag HG13670-NY
    Calcineurin A cDNA ORF Clone, Human, C-Myc tag HG13670-CM
    Calcineurin A cDNA ORF Clone, Human, N-Myc tag HG13669-NM
    Calcineurin A cDNA ORF Clone, Human, N-Myc tag HG13670-NM
    Calcineurin A qPCR Primer Pairs, Human HP102349
    info info
    添加购物车成功! 添加购物车失败!