Quick Order

Human PPM1G Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PPM1G cDNA Clone Product Information
NCBI RefSeq:NM_177983.1
RefSeq ORF Size:1641bp
cDNA Description:Full length Clone DNA of Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent, 1G with C terminal His tag.
Gene Synonym:PP2CG, PPP2CG, MGC1675, MGC2870, PP2CGAMMA, PPM1G
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

References
  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.
  • Size / Price
    Catalog: HG11245-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"