PPIL2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14418-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPIL2 Reagents
CRO Services
Product recommended

All PPIL2 Reagents
PPIL2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1584 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase (cyclophilin)-like 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPIL2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CYC4 cDNA ORF Clone, Human;Cyp-60 cDNA ORF Clone, Human;CYP60 cDNA ORF Clone, Human;hCyP-60 cDNA ORF Clone, Human;UBOX7 cDNA ORF Clone, Human
PPIL2 Background Information

PPIL2, is an enzyme which belongs to the cyclophilin family. The cyclophilins are peptidylprolyl isomerases and are highly conserved ubiquitous. They play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL2 interacts with the proteinase inhibitor eglin c and is localized in the nucleus. It contains 1 PPIL2 cyclophilin-type domain and 1 U-box domain. PPIL2 accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.

Full Name
peptidylprolyl isomerase (cyclophilin)-like 2
References
  • Grouse LH. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Payan DG. et al., 1996, Biochem J. 314 (1): 313-9.
  • PPIL2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PPIL2 cDNA ORF Clone in Cloning Vector, Rat RG81253-U
    PPIL2 cDNA ORF Clone, Rat, untagged RG81253-UT
    PPIL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81253-ACG
    PPIL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81253-ACGLN
    PPIL2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81253-ANG
    PPIL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81253-ACR
    PPIL2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81253-ANR
    PPIL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81253-CF
    PPIL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81253-NF
    PPIL2 cDNA ORF Clone, Rat, C-His tag RG81253-CH
    PPIL2 cDNA ORF Clone, Rat, N-His tag RG81253-NH
    PPIL2 cDNA ORF Clone, Rat, C-HA tag RG81253-CY
    PPIL2 cDNA ORF Clone, Rat, N-HA tag RG81253-NY
    PPIL2 cDNA ORF Clone, Rat, C-Myc tag RG81253-CM
    PPIL2 cDNA ORF Clone, Rat, N-Myc tag RG81253-NM
    PPIL2 qPCR Primer Pairs, Rat RP301209

    PPIL2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PPIL2 cDNA ORF Clone in Cloning Vector, Human HG14418-G
    PPIL2 cDNA ORF Clone, Human, untagged HG14418-UT
    PPIL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14418-ACG
    PPIL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14418-ACGLN
    PPIL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14418-ANG
    PPIL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14418-ACR
    PPIL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14418-ANR
    PPIL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14418-CF
    PPIL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14418-NF
    PPIL2 cDNA ORF Clone, Human, C-His tag HG14418-CH
    PPIL2 cDNA ORF Clone, Human, N-His tag HG14418-NH
    PPIL2 cDNA ORF Clone, Human, C-HA tag HG14418-CY
    PPIL2 cDNA ORF Clone, Human, N-HA tag HG14418-NY
    PPIL2 cDNA ORF Clone, Human, C-Myc tag HG14418-CM
    PPIL2 qPCR Primer Pairs, Human HP103067
    info info
    添加购物车成功! 添加购物车失败!