PPIL1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14163-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPIL1 Reagents
CRO Services
Product recommended

All PPIL1 Reagents
PPIL1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase (cyclophilin)-like 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPIL1 cDNA ORF Clone, Human, N-HA tag Alternative Names
CGI-124 cDNA ORF Clone, Human;CYPL1 cDNA ORF Clone, Human;hCyPX cDNA ORF Clone, Human;PPIase cDNA ORF Clone, Human
PPIL1 Background Information

PPIL1 is a member of the cyclophilin family. Cyclophilins are well conserved and ubiquitous. Members of cyclophilin family take an significant part in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL1 is a peptidylprolyl isomerase(PPIase). It increases the folding of proteins and catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIL1 is involved in proliferation of cancer cells through modulation of phosphorylation of stathmin. It is a novel molecular target for colon-cancer therapy.

Full Name
peptidylprolyl isomerase (cyclophilin)-like 1
References
  • Xu C. et al., 2005, J Biomol NMR. 31 (2): 179-80.
  • Ozaki K. et al., 1997, Cytogenet Cell Genet. 72 (2-3): 242-5.
  • Mann SS. et al., 1999, Cytogenet Cell Genet. 83 (3-4): 228-9.
  • PPIL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PPIL1 cDNA ORF Clone in Cloning Vector, Rat RG88214-U
    PPIL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88214-ACGLN

    PPIL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PPIL1 cDNA ORF Clone in Cloning Vector, Mouse MG53769-U
    PPIL1 cDNA ORF Clone, Mouse, untagged MG53769-UT
    PPIL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53769-ACG
    PPIL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53769-ACGLN
    PPIL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53769-ANG
    PPIL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53769-ACR
    PPIL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53769-ANR
    PPIL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53769-CF
    PPIL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53769-NF
    PPIL1 cDNA ORF Clone, Mouse, C-His tag MG53769-CH
    PPIL1 cDNA ORF Clone, Mouse, N-His tag MG53769-NH
    PPIL1 cDNA ORF Clone, Mouse, C-HA tag MG53769-CY
    PPIL1 cDNA ORF Clone, Mouse, N-HA tag MG53769-NY
    PPIL1 cDNA ORF Clone, Mouse, C-Myc tag MG53769-CM
    PPIL1 cDNA ORF Clone, Mouse, N-Myc tag MG53769-NM

    PPIL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PPIL1 cDNA ORF Clone in Cloning Vector, Human HG14163-G
    PPIL1 cDNA ORF Clone, Human, untagged HG14163-UT
    PPIL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14163-ACG
    PPIL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14163-ACGLN
    PPIL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14163-ANG
    PPIL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14163-ACR
    PPIL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14163-ANR
    PPIL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14163-CF
    PPIL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14163-NF
    PPIL1 cDNA ORF Clone, Human, C-His tag HG14163-CH
    PPIL1 cDNA ORF Clone, Human, N-His tag HG14163-NH
    PPIL1 cDNA ORF Clone, Human, C-HA tag HG14163-CY
    PPIL1 cDNA ORF Clone, Human, C-Myc tag HG14163-CM
    PPIL1 cDNA ORF Clone, Human, N-Myc tag HG14163-NM
    PPIL1 qPCR Primer Pairs, Human HP102814
    info info
    添加购物车成功! 添加购物车失败!