Quick Order

Human PPIL1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human PPIL1 cDNA Clone Product Information
NCBI RefSeq:BC003048
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 1 with C terminal Myc tag.
Gene Synonym:CGI-124, CYPL1, MGC678, PPIase, hCyPX, PPIL1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PPIL1 is a member of the cyclophilin family. Cyclophilins are well conserved and ubiquitous. Members of cyclophilin family take an significant part in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL1 is a peptidylprolyl isomerase(PPIase). It increases the folding of proteins and catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIL1 is involved in proliferation of cancer cells through modulation of phosphorylation of stathmin. It is a novel molecular target for colon-cancer therapy.

References
  • Xu C. et al., 2005, J Biomol NMR. 31 (2): 179-80.
  • Ozaki K. et al., 1997, Cytogenet Cell Genet. 72 (2-3): 242-5.
  • Mann SS. et al., 1999, Cytogenet Cell Genet. 83 (3-4): 228-9.
  • Size / Price
    Catalog: HG14163-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"