Quick Order

Text Size:AAA

Human PPIL1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PPIL1 cDNA Clone Product Information
NCBI RefSeq:BC003048
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 1 with C terminal HA tag.
Gene Synonym:CGI-124, CYPL1, MGC678, PPIase, hCyPX, PPIL1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PPIL1 is a member of the cyclophilin family. Cyclophilins are well conserved and ubiquitous. Members of cyclophilin family take an significant part in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL1 is a peptidylprolyl isomerase(PPIase). It increases the folding of proteins and catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIL1 is involved in proliferation of cancer cells through modulation of phosphorylation of stathmin. It is a novel molecular target for colon-cancer therapy.

References
  • Xu C. et al., 2005, J Biomol NMR. 31 (2): 179-80.
  • Ozaki K. et al., 1997, Cytogenet Cell Genet. 72 (2-3): 242-5.
  • Mann SS. et al., 1999, Cytogenet Cell Genet. 83 (3-4): 228-9.
  • Size / Price
    Catalog: HG14163-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"