PPIE cDNA ORF Clone, Human, C-Myc tag

Cat: HG14791-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPIE Reagents
CRO Services
Product recommended

All PPIE Reagents
PPIE cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase E (cyclophilin E) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPIE cDNA ORF Clone, Human, C-Myc tag Alternative Names
CYP-33 cDNA ORF Clone, Human;CYP33 cDNA ORF Clone, Human
PPIE Background Information
Full Name
peptidylprolyl isomerase E (cyclophilin E)

PPIE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPIE cDNA ORF Clone in Cloning Vector, Mouse MG53919-U
PPIE cDNA ORF Clone, Mouse, untagged MG53919-UT
PPIE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53919-ACGLN
PPIE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53919-ACG
PPIE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53919-ANG
PPIE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53919-ACR
PPIE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53919-ANR
PPIE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53919-CF
PPIE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53919-NF
PPIE cDNA ORF Clone, Mouse, C-His tag MG53919-CH
PPIE cDNA ORF Clone, Mouse, N-His tag MG53919-NH
PPIE cDNA ORF Clone, Mouse, C-HA tag MG53919-CY
PPIE cDNA ORF Clone, Mouse, N-HA tag MG53919-NY
PPIE cDNA ORF Clone, Mouse, C-Myc tag MG53919-CM
PPIE cDNA ORF Clone, Mouse, N-Myc tag MG53919-NM

PPIE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPIE cDNA ORF Clone in Cloning Vector, Human HG14791-G
PPIE cDNA ORF Clone, Human, untagged HG14791-UT
PPIE cDNA ORF Clone, Human, C-GFPSpark® tag HG14791-ACG
PPIE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14791-ACGLN
PPIE cDNA ORF Clone, Human, N-GFPSpark® tag HG14791-ANG
PPIE cDNA ORF Clone, Human, C-OFPSpark® tag HG14791-ACR
PPIE cDNA ORF Clone, Human, N-OFPSpark® tag HG14791-ANR
PPIE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14791-CF
PPIE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14791-NF
PPIE cDNA ORF Clone, Human, C-His tag HG14791-CH
PPIE cDNA ORF Clone, Human, N-His tag HG14791-NH
PPIE cDNA ORF Clone, Human, C-HA tag HG14791-CY
PPIE cDNA ORF Clone, Human, N-HA tag HG14791-NY
PPIE cDNA ORF Clone, Human, N-Myc tag HG14791-NM
PPIE qPCR Primer Pairs, Human HP103424
info info
添加购物车成功! 添加购物车失败!