Quick Order

Text Size:AAA

Human PPARGC1A natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PPARGC1A cDNA Clone Product Information
NCBI RefSeq:NM_013261.3
RefSeq ORF Size:2397bp
cDNA Description:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma, coactivator 1 alpha.
Gene Synonym:LEM6, PGC1, PGC1A, PGC-1v, PPARGC1, PGC-1(alpha), PPARGC1A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PPARGC1A
Restriction Site:KpnI + NotI (6.1kb + 2.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1182 A>G and 1584 G>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PPARGC1A Gene Plasmid Map
Human PPARGC1A natural ORF mammalian expression plasmid
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"