PPAR gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12019-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPAR gamma Reagents
CRO Services
Product recommended

All PPAR gamma Reagents
PPAR gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.57kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PPAR gamma cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPAR gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human PPARG Gene Expression validated Image 1870
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
PPAR gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CIMT1 cDNA ORF Clone, Human;GLM1 cDNA ORF Clone, Human;NR1C3 cDNA ORF Clone, Human;PPARG1 cDNA ORF Clone, Human;PPARG2 cDNA ORF Clone, Human;PPARgamma cDNA ORF Clone, Human
PPAR gamma Background Information
Full Name
peroxisome proliferator-activated receptor gamma
References
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • PPAR gamma cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Rat RG80954-U
    PPAR gamma cDNA ORF Clone, Rat, untagged RG80954-UT
    PPAR gamma Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80954-ACGLN
    PPAR gamma cDNA ORF Clone, Rat, C-GFPSpark® tag RG80954-ACG
    PPAR gamma cDNA ORF Clone, Rat, N-GFPSpark® tag RG80954-ANG
    PPAR gamma cDNA ORF Clone, Rat, C-OFPSpark® tag RG80954-ACR
    PPAR gamma cDNA ORF Clone, Rat, N-OFPSpark® tag RG80954-ANR
    PPAR gamma cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80954-CF
    PPAR gamma cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80954-NF
    PPAR gamma cDNA ORF Clone, Rat, C-His tag RG80954-CH
    PPAR gamma cDNA ORF Clone, Rat, N-His tag RG80954-NH
    PPAR gamma cDNA ORF Clone, Rat, C-HA tag RG80954-CY
    PPAR gamma cDNA ORF Clone, Rat, N-HA tag RG80954-NY
    PPAR gamma cDNA ORF Clone, Rat, C-Myc tag RG80954-CM
    PPAR gamma cDNA ORF Clone, Rat, N-Myc tag RG80954-NM
    PPAR gamma qPCR Primer Pairs, Rat RP300918

    PPAR gamma cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Mouse MG53363-U
    PPAR gamma cDNA ORF Clone, Mouse, untagged MG53363-UT
    PPAR gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53363-ACG
    PPAR gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53363-ACGLN
    PPAR gamma cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53363-ANG
    PPAR gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53363-ACR
    PPAR gamma cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53363-ANR
    PPAR gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53363-CF
    PPAR gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53363-NF
    PPAR gamma cDNA ORF Clone, Mouse, C-His tag MG53363-CH
    PPAR gamma cDNA ORF Clone, Mouse, N-His tag MG53363-NH
    PPAR gamma cDNA ORF Clone, Mouse, C-HA tag MG53363-CY
    PPAR gamma cDNA ORF Clone, Mouse, N-HA tag MG53363-NY
    PPAR gamma cDNA ORF Clone, Mouse, C-Myc tag MG53363-CM
    PPAR gamma cDNA ORF Clone, Mouse, N-Myc tag MG53363-NM

    PPAR gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Human HG12019-G
    PPAR gamma cDNA ORF Clone, Human, untagged HG12019-UT
    PPAR gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12019-ACGLN
    PPAR gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG12019-ACG
    PPAR gamma cDNA ORF Clone, Human, N-GFPSpark® tag HG12019-ANG
    PPAR gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG12019-ACR
    PPAR gamma cDNA ORF Clone, Human, N-OFPSpark® tag HG12019-ANR
    PPAR gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12019-NF
    PPAR gamma cDNA ORF Clone, Human, C-His tag HG12019-CH
    PPAR gamma cDNA ORF Clone, Human, N-His tag HG12019-NH
    PPAR gamma cDNA ORF Clone, Human, C-HA tag HG12019-CY
    PPAR gamma cDNA ORF Clone, Human, N-HA tag HG12019-NY
    PPAR gamma cDNA ORF Clone, Human, C-Myc tag HG12019-CM
    PPAR gamma cDNA ORF Clone, Human, N-Myc tag HG12019-NM
    PPAR gamma qPCR Primer Pairs, Human HP101555
    info info
    添加购物车成功! 添加购物车失败!