PON2 cDNA ORF Clone, Human, C-His tag

Cat: HG11272-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PON2 Reagents
CRO Services
Product recommended

All PON2 Reagents
PON2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human paraoxonase 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PON2 Background Information
Full Name
paraoxonase 2

PON2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PON2 cDNA ORF Clone in Cloning Vector, Mouse MG53770-U
PON2 cDNA ORF Clone, Mouse, untagged MG53770-UT
PON2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53770-ACGLN
PON2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53770-ACG
PON2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53770-ACR
PON2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53770-CF
PON2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53770-NF
PON2 cDNA ORF Clone, Mouse, C-His tag MG53770-CH
PON2 cDNA ORF Clone, Mouse, N-His tag MG53770-NH
PON2 cDNA ORF Clone, Mouse, C-HA tag MG53770-CY
PON2 cDNA ORF Clone, Mouse, N-HA tag MG53770-NY
PON2 cDNA ORF Clone, Mouse, C-Myc tag MG53770-CM
PON2 cDNA ORF Clone, Mouse, N-Myc tag MG53770-NM

PON2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PON2 cDNA ORF Clone in Cloning Vector, Human HG11272-M
PON2 cDNA ORF Clone, Human, untagged HG11272-UT
PON2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11272-ACG
PON2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11272-ACGLN
PON2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11272-ACR
PON2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11272-CF
PON2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11272-NF
PON2 cDNA ORF Clone, Human, N-His tag HG11272-NH
PON2 cDNA ORF Clone, Human, C-HA tag HG11272-CY
PON2 cDNA ORF Clone, Human, N-HA tag HG11272-NY
PON2 cDNA ORF Clone, Human, C-Myc tag HG11272-CM
PON2 cDNA ORF Clone, Human, N-Myc tag HG11272-NM
PON2 qPCR Primer Pairs, Human HP101155
info info
添加购物车成功! 添加购物车失败!