PNLIPRP1 cDNA ORF Clone, Human, N-HA tag

Cat: HG13565-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PNLIPRP1 Reagents
CRO Services
Product recommended

All PNLIPRP1 Reagents
PNLIPRP1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Human pancreatic lipase-related protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PNLIPRP1 cDNA ORF Clone, Human, N-HA tag Alternative Names
PLRP1 cDNA ORF Clone, Human
PNLIPRP1 Background Information

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

Full Name
pancreatic lipase-related protein 1
References
  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • PNLIPRP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PNLIPRP1 cDNA ORF Clone in Cloning Vector, Rat RG80624-U
    PNLIPRP1 cDNA ORF Clone, Rat, untagged RG80624-UT
    PNLIPRP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80624-ACG
    PNLIPRP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80624-ACGLN
    PNLIPRP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80624-ACR
    PNLIPRP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80624-CF
    PNLIPRP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80624-NF
    PNLIPRP1 cDNA ORF Clone, Rat, C-His tag RG80624-CH
    PNLIPRP1 cDNA ORF Clone, Rat, N-His tag RG80624-NH
    PNLIPRP1 cDNA ORF Clone, Rat, C-HA tag RG80624-CY
    PNLIPRP1 cDNA ORF Clone, Rat, N-HA tag RG80624-NY
    PNLIPRP1 cDNA ORF Clone, Rat, C-Myc tag RG80624-CM
    PNLIPRP1 cDNA ORF Clone, Rat, N-Myc tag RG80624-NM
    PNLIPRP1 qPCR Primer Pairs, Rat RP300588

    PNLIPRP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PNLIPRP1 cDNA ORF Clone in Cloning Vector, Mouse MG52901-G
    PNLIPRP1 cDNA ORF Clone, Mouse, untagged MG52901-UT
    PNLIPRP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52901-ACG
    PNLIPRP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52901-ACGLN
    PNLIPRP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52901-ANG
    PNLIPRP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52901-ACR
    PNLIPRP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52901-ANR
    PNLIPRP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52901-CF
    PNLIPRP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52901-NF
    PNLIPRP1 cDNA ORF Clone, Mouse, C-His tag MG52901-CH
    PNLIPRP1 cDNA ORF Clone, Mouse, N-His tag MG52901-NH
    PNLIPRP1 cDNA ORF Clone, Mouse, C-HA tag MG52901-CY
    PNLIPRP1 cDNA ORF Clone, Mouse, N-HA tag MG52901-NY
    PNLIPRP1 cDNA ORF Clone, Mouse, C-Myc tag MG52901-CM
    PNLIPRP1 cDNA ORF Clone, Mouse, N-Myc tag MG52901-NM

    PNLIPRP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PNLIPRP1 cDNA ORF Clone in Cloning Vector, Human HG13565-G
    PNLIPRP1 cDNA ORF Clone, Human, untagged HG13565-UT
    PNLIPRP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13565-ACG
    PNLIPRP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13565-ACGLN
    PNLIPRP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13565-ACR
    PNLIPRP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13565-CF
    PNLIPRP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13565-NF
    PNLIPRP1 cDNA ORF Clone, Human, C-His tag HG13565-CH
    PNLIPRP1 cDNA ORF Clone, Human, N-His tag HG13565-NH
    PNLIPRP1 cDNA ORF Clone, Human, C-HA tag HG13565-CY
    PNLIPRP1 cDNA ORF Clone, Human, C-Myc tag HG13565-CM
    PNLIPRP1 cDNA ORF Clone, Human, N-Myc tag HG13565-NM
    PNLIPRP1 qPCR Primer Pairs, Human HP102251
    info info
    添加购物车成功! 添加购物车失败!