PNLIP cDNA ORF Clone, Human, C-HA tag

Cat: HG13564-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PNLIP Reagents
CRO Services
Product recommended

All PNLIP Reagents
PNLIP cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Human pancreatic lipase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PNLIP cDNA ORF Clone, Human, C-HA tag Alternative Names
PL cDNA ORF Clone, Human;PNLIPD cDNA ORF Clone, Human;PTL cDNA ORF Clone, Human
PNLIP Background Information

PNLIP is an enzyme which belongs to the lipase family. Secreted from the pancreas, PNLIP is the primary lipase that hydrolyzes dietary fat molecules in the human digestive system, converting triglyceride substrates found in ingested oils to monoglycerides and free fatty acids. Bile salts secreted from the liver and stored in gallbladder are released into the duodenum where they coat and emulsify large fat droplets into smaller droplets, thus increasing the overall surface area of the fat, which allows the lipase to break apart the fat more effectively. The resulting monomers (2 free fatty acids and one 2-monoacylglycerol) are then moved by way of peristalsis along the small intestine to be absorbed into the lymphatic system by a specialized vessel called a lacteal.

Full Name
pancreatic lipase
References
  • Hegele RA, et al. (2001) Polymorphisms in PNLIP, encoding pancreatic lipase, and associations with metabolic traits. J Hum Genet. 46(6):320-4.
  • Thomas A, et al. (2005) Role of the lid hydrophobicity pattern in pancreatic lipase activity. J Biol Chem. 280(48):40074-83.
  • Colin DY, et al. (2008) Exploring the active site cavity of human pancreatic lipase. Biochem Biophys Res Commun. 370(3):394-8.
  • PNLIP cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PNLIP cDNA ORF Clone in Cloning Vector, Rhesus CG90537-U
    PNLIP cDNA ORF Clone, Rhesus, untagged CG90537-UT
    PNLIP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90537-ACGLN
    PNLIP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90537-ACG
    PNLIP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90537-ACR
    PNLIP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90537-CF
    PNLIP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90537-NF
    PNLIP cDNA ORF Clone, Rhesus, C-His tag CG90537-CH
    PNLIP cDNA ORF Clone, Rhesus, N-His tag CG90537-NH
    PNLIP cDNA ORF Clone, Rhesus, C-HA tag CG90537-CY
    PNLIP cDNA ORF Clone, Rhesus, N-HA tag CG90537-NY
    PNLIP cDNA ORF Clone, Rhesus, C-Myc tag CG90537-CM
    PNLIP cDNA ORF Clone, Rhesus, N-Myc tag CG90537-NM

    PNLIP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PNLIP cDNA ORF Clone in Cloning Vector, Rat RG83426-U
    PNLIP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83426-ACGLN

    PNLIP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PNLIP cDNA ORF Clone in Cloning Vector, Mouse MG53859-U
    PNLIP cDNA ORF Clone, Mouse, untagged MG53859-UT
    PNLIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53859-ACGLN
    PNLIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53859-ACG
    PNLIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53859-ACR
    PNLIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53859-CF
    PNLIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53859-NF
    PNLIP cDNA ORF Clone, Mouse, C-His tag MG53859-CH
    PNLIP cDNA ORF Clone, Mouse, N-His tag MG53859-NH
    PNLIP cDNA ORF Clone, Mouse, C-HA tag MG53859-CY
    PNLIP cDNA ORF Clone, Mouse, N-HA tag MG53859-NY
    PNLIP cDNA ORF Clone, Mouse, C-Myc tag MG53859-CM
    PNLIP cDNA ORF Clone, Mouse, N-Myc tag MG53859-NM

    PNLIP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PNLIP cDNA ORF Clone in Cloning Vector, Human HG13564-G
    PNLIP cDNA ORF Clone, Human, untagged HG13564-UT
    PNLIP cDNA ORF Clone, Human, C-GFPSpark® tag HG13564-ACG
    PNLIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13564-ACGLN
    PNLIP cDNA ORF Clone, Human, C-OFPSpark® tag HG13564-ACR
    PNLIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13564-CF
    PNLIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13564-NF
    PNLIP cDNA ORF Clone, Human, C-His tag HG13564-CH
    PNLIP cDNA ORF Clone, Human, N-His tag HG13564-NH
    PNLIP cDNA ORF Clone, Human, N-HA tag HG13564-NY
    PNLIP cDNA ORF Clone, Human, C-Myc tag HG13564-CM
    PNLIP cDNA ORF Clone, Human, N-Myc tag HG13564-NM
    PNLIP qPCR Primer Pairs, Human HP102250
    info info
    添加购物车成功! 添加购物车失败!