PMP22 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14519-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PMP22 Reagents
CRO Services
Product recommended

All PMP22 Reagents
PMP22 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
522 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peripheral myelin protein 22 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.52kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PMP22 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PMP22 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
PMP22 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CMT1A cDNA ORF Clone, Human;CMT1E cDNA ORF Clone, Human;DSS cDNA ORF Clone, Human;GAS-3 cDNA ORF Clone, Human;HMSNIA cDNA ORF Clone, Human;HNPP cDNA ORF Clone, Human;Sp110 cDNA ORF Clone, Human
PMP22 Background Information
Full Name
peripheral myelin protein 22

PMP22 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PMP22 cDNA ORF Clone in Cloning Vector, Rabbit TG65085-G
PMP22 cDNA ORF Clone, Rabbit, untagged TG65085-UT
PMP22 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65085-ACG
PMP22 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65085-ANG
PMP22 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65085-ACR
PMP22 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65085-ANR
PMP22 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65085-CF
PMP22 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65085-NF
PMP22 cDNA ORF Clone, Rabbit, C-His tag TG65085-CH
PMP22 cDNA ORF Clone, Rabbit, N-His tag TG65085-NH
PMP22 cDNA ORF Clone, Rabbit, C-HA tag TG65085-CY
PMP22 cDNA ORF Clone, Rabbit, N-HA tag TG65085-NY
PMP22 cDNA ORF Clone, Rabbit, C-Myc tag TG65085-CM
PMP22 cDNA ORF Clone, Rabbit, N-Myc tag TG65085-NM

PMP22 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PMP22 cDNA ORF Clone in Cloning Vector, Rat RG80672-U
PMP22 cDNA ORF Clone, Rat, untagged RG80672-UT
PMP22 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80672-ACGLN
PMP22 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80672-ACG
PMP22 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80672-ACR
PMP22 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80672-CF
PMP22 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80672-NF
PMP22 cDNA ORF Clone, Rat, C-His tag RG80672-CH
PMP22 cDNA ORF Clone, Rat, N-His tag RG80672-NH
PMP22 cDNA ORF Clone, Rat, C-HA tag RG80672-CY
PMP22 cDNA ORF Clone, Rat, N-HA tag RG80672-NY
PMP22 cDNA ORF Clone, Rat, C-Myc tag RG80672-CM
PMP22 cDNA ORF Clone, Rat, N-Myc tag RG80672-NM
PMP22 qPCR Primer Pairs, Rat RP300636

PMP22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PMP22 cDNA ORF Clone in Cloning Vector, Mouse MG51684-G
PMP22 cDNA ORF Clone, Mouse, untagged MG51684-UT
PMP22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51684-ACG
PMP22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51684-ACGLN
PMP22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51684-ANG
PMP22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51684-ACR
PMP22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51684-ANR
PMP22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51684-CF
PMP22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51684-NF
PMP22 cDNA ORF Clone, Mouse, C-His tag MG51684-CH
PMP22 cDNA ORF Clone, Mouse, N-His tag MG51684-NH
PMP22 cDNA ORF Clone, Mouse, C-HA tag MG51684-CY
PMP22 cDNA ORF Clone, Mouse, N-HA tag MG51684-NY
PMP22 cDNA ORF Clone, Mouse, C-Myc tag MG51684-CM
PMP22 cDNA ORF Clone, Mouse, N-Myc tag MG51684-NM
PMP22 qPCR Primer Pairs, Mouse MP201557

PMP22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PMP22 cDNA ORF Clone in Cloning Vector, Human HG14519-G
PMP22 cDNA ORF Clone, Human, untagged HG14519-UT
PMP22 cDNA ORF Clone, Human, C-GFPSpark® tag HG14519-ACG
PMP22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14519-ACGLN
PMP22 cDNA ORF Clone, Human, C-OFPSpark® tag HG14519-ACR
PMP22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14519-G-F
PMP22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14519-NF
PMP22 cDNA ORF Clone, Human, C-His tag HG14519-CH
PMP22 cDNA ORF Clone, Human, N-His tag HG14519-NH
PMP22 cDNA ORF Clone, Human, C-HA tag HG14519-CY
PMP22 cDNA ORF Clone, Human, N-HA tag HG14519-NY
PMP22 cDNA ORF Clone, Human, C-Myc tag HG14519-CM
PMP22 cDNA ORF Clone, Human, N-Myc tag HG14519-NM
PMP22 qPCR Primer Pairs, Human HP103166
info info
添加购物车成功! 添加购物车失败!