PMM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14648-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PMM2 Reagents
CRO Services
Product recommended

All PMM2 Reagents
PMM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Human phosphomannomutase 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PMM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CDG1 cDNA ORF Clone, Human;CDG1a cDNA ORF Clone, Human;CDGS cDNA ORF Clone, Human;PMI cDNA ORF Clone, Human;PMI1 cDNA ORF Clone, Human;PMM2 cDNA ORF Clone, Human
PMM2 Background Information

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

Full Name
phosphomannomutase 2
References
  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • PMM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PMM2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1144-U
    PMM2 cDNA ORF Clone, Mouse, untagged MG5A1144-UT
    PMM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1144-ACGLN
    PMM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1144-ACG
    PMM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1144-ANG
    PMM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1144-ACR
    PMM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1144-ANR
    PMM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1144-CF
    PMM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1144-NF
    PMM2 cDNA ORF Clone, Mouse, C-His tag MG5A1144-CH
    PMM2 cDNA ORF Clone, Mouse, N-His tag MG5A1144-NH
    PMM2 cDNA ORF Clone, Mouse, C-HA tag MG5A1144-CY
    PMM2 cDNA ORF Clone, Mouse, N-HA tag MG5A1144-NY
    PMM2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1144-CM
    PMM2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1144-NM

    PMM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PMM2 cDNA ORF Clone in Cloning Vector, Human HG14648-G
    PMM2 cDNA ORF Clone, Human, untagged HG14648-UT
    PMM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14648-ACG
    PMM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14648-ACGLN
    PMM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14648-ANG
    PMM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14648-ACR
    PMM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14648-ANR
    PMM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14648-CF
    PMM2 cDNA ORF Clone, Human, C-His tag HG14648-CH
    PMM2 cDNA ORF Clone, Human, N-His tag HG14648-NH
    PMM2 cDNA ORF Clone, Human, C-HA tag HG14648-CY
    PMM2 cDNA ORF Clone, Human, N-HA tag HG14648-NY
    PMM2 cDNA ORF Clone, Human, C-Myc tag HG14648-CM
    PMM2 cDNA ORF Clone, Human, N-Myc tag HG14648-NM
    PMM2 qPCR Primer Pairs, Human HP103282
    info info
    添加购物车成功! 添加购物车失败!