Quick Order

Text Size:AAA

Human phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PMM2 cDNA Clone Product Information
NCBI RefSeq:BC008310
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with C terminal His tag.
Gene Synonym:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Background

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

References
  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • Size / Price
    Catalog: HG14648-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"