SILV cDNA ORF Clone, Human, C-Myc tag

Cat: HG13693-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SILV Reagents
CRO Services
Product recommended

All SILV Reagents
SILV cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1986 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human premelanosome protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb + 1.16kb + 0.87kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SILV cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
More Information About SILV
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SILV cDNA ORF Clone, Human, C-Myc tag Validated Images
Human SILV Gene Plasmid Map 7735
SILV cDNA ORF Clone, Human, C-Myc tag Alternative Names
D12S53E cDNA ORF Clone, Human;gp100 cDNA ORF Clone, Human;ME20 cDNA ORF Clone, Human;ME20-M cDNA ORF Clone, Human;ME20M cDNA ORF Clone, Human;P1 cDNA ORF Clone, Human;P100 cDNA ORF Clone, Human;PMEL17 cDNA ORF Clone, Human;SI cDNA ORF Clone, Human;SIL cDNA ORF Clone, Human;SILV cDNA ORF Clone, Human
SILV Background Information

SILV gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
premelanosome protein
References
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
  • SILV cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SILV cDNA ORF Clone in Cloning Vector, Mouse MG58556-U
    SILV cDNA ORF Clone, Mouse, untagged MG58556-UT
    SILV cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58556-ACG
    SILV Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58556-ACGLN
    SILV cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58556-ACR
    SILV cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58556-CF
    SILV cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58556-NF
    SILV cDNA ORF Clone, Mouse, C-His tag MG58556-CH
    SILV cDNA ORF Clone, Mouse, N-His tag MG58556-NH
    SILV cDNA ORF Clone, Mouse, C-HA tag MG58556-CY
    SILV cDNA ORF Clone, Mouse, N-HA tag MG58556-NY
    SILV cDNA ORF Clone, Mouse, C-Myc tag MG58556-CM
    SILV cDNA ORF Clone, Mouse, N-Myc tag MG58556-NM

    SILV cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SILV cDNA ORF Clone in Cloning Vector, Human HG13693-G
    SILV cDNA ORF Clone, Human, untagged HG13693-UT
    SILV Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13693-ACGLN
    SILV cDNA ORF Clone, Human, C-GFPSpark® tag HG13693-ACG
    SILV cDNA ORF Clone, Human, C-OFPSpark® tag HG13693-ACR
    SILV cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13693-CF
    SILV cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13693-NF
    SILV cDNA ORF Clone, Human, C-His tag HG13693-CH
    SILV cDNA ORF Clone, Human, N-His tag HG13693-NH
    SILV cDNA ORF Clone, Human, C-HA tag HG13693-CY
    SILV cDNA ORF Clone, Human, N-HA tag HG13693-NY
    SILV cDNA ORF Clone, Human, N-Myc tag HG13693-NM
    SILV qPCR Primer Pairs, Human HP102372
    info info
    添加购物车成功! 添加购物车失败!