PLSCR4 cDNA ORF Clone, Human, C-HA tag

Cat: HG14721-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLSCR4 Reagents
CRO Services
Product recommended

All PLSCR4 Reagents
PLSCR4 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human phospholipid scramblase 4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLSCR4 cDNA ORF Clone, Human, C-HA tag Alternative Names
TRA1 cDNA ORF Clone, Human
PLSCR4 Background Information
Full Name
phospholipid scramblase 4

PLSCR4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLSCR4 cDNA ORF Clone in Cloning Vector, Rat RG80972-U
PLSCR4 cDNA ORF Clone, Rat, untagged RG80972-UT
PLSCR4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80972-ACGLN
PLSCR4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80972-ACG
PLSCR4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80972-ACR
PLSCR4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80972-CF
PLSCR4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80972-NF
PLSCR4 cDNA ORF Clone, Rat, C-His tag RG80972-CH
PLSCR4 cDNA ORF Clone, Rat, N-His tag RG80972-NH
PLSCR4 cDNA ORF Clone, Rat, C-HA tag RG80972-CY
PLSCR4 cDNA ORF Clone, Rat, N-HA tag RG80972-NY
PLSCR4 cDNA ORF Clone, Rat, C-Myc tag RG80972-CM
PLSCR4 cDNA ORF Clone, Rat, N-Myc tag RG80972-NM
PLSCR4 qPCR Primer Pairs, Rat RP300936

PLSCR4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLSCR4 cDNA ORF Clone in Cloning Vector, Mouse MG5A3212-U
PLSCR4 cDNA ORF Clone, Mouse, untagged MG5A3212-UT
PLSCR4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3212-ACGLN
PLSCR4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3212-ACG
PLSCR4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3212-ANG
PLSCR4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3212-ACR
PLSCR4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3212-ANR
PLSCR4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3212-CF
PLSCR4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3212-NF
PLSCR4 cDNA ORF Clone, Mouse, C-His tag MG5A3212-CH
PLSCR4 cDNA ORF Clone, Mouse, N-His tag MG5A3212-NH
PLSCR4 cDNA ORF Clone, Mouse, C-HA tag MG5A3212-CY
PLSCR4 cDNA ORF Clone, Mouse, N-HA tag MG5A3212-NY
PLSCR4 cDNA ORF Clone, Mouse, C-Myc tag MG5A3212-CM
PLSCR4 cDNA ORF Clone, Mouse, N-Myc tag MG5A3212-NM

PLSCR4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLSCR4 cDNA ORF Clone in Cloning Vector, Human HG14721-G
PLSCR4 cDNA ORF Clone, Human, untagged HG14721-UT
PLSCR4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14721-ACG
PLSCR4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14721-ACGLN
PLSCR4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14721-ACR
PLSCR4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14721-CF
PLSCR4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14721-NF
PLSCR4 cDNA ORF Clone, Human, C-His tag HG14721-CH
PLSCR4 cDNA ORF Clone, Human, N-His tag HG14721-NH
PLSCR4 cDNA ORF Clone, Human, N-HA tag HG14721-NY
PLSCR4 cDNA ORF Clone, Human, C-Myc tag HG14721-CM
PLSCR4 cDNA ORF Clone, Human, N-Myc tag HG14721-NM
PLSCR4 qPCR Primer Pairs, Human HP103354
info info
添加购物车成功! 添加购物车失败!