Perilipin 3 cDNA ORF Clone, Human, C-HA tag

Cat: HG14091-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Perilipin 3 Reagents
CRO Services
Product recommended

All Perilipin 3 Reagents
Perilipin 3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human perilipin 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.35kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Perilipin 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Perilipin 3 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Perilipin 3 cDNA ORF Clone, Human, C-HA tag Alternative Names
M6PRBP1 cDNA ORF Clone, Human;PP17 cDNA ORF Clone, Human;TIP47 cDNA ORF Clone, Human
Perilipin 3 Background Information
Full Name
perilipin 3

Perilipin 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Rat RG81094-U
Perilipin 3 cDNA ORF Clone, Rat, untagged RG81094-UT
Perilipin 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81094-ACGLN
Perilipin 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81094-ACG
Perilipin 3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81094-ANG
Perilipin 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81094-ACR
Perilipin 3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81094-ANR
Perilipin 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81094-CF
Perilipin 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81094-NF
Perilipin 3 cDNA ORF Clone, Rat, C-His tag RG81094-CH
Perilipin 3 cDNA ORF Clone, Rat, N-His tag RG81094-NH
Perilipin 3 cDNA ORF Clone, Rat, C-HA tag RG81094-CY
Perilipin 3 cDNA ORF Clone, Rat, N-HA tag RG81094-NY
Perilipin 3 cDNA ORF Clone, Rat, C-Myc tag RG81094-CM
Perilipin 3 cDNA ORF Clone, Rat, N-Myc tag RG81094-NM
Perilipin 3 qPCR Primer Pairs, Rat RP301051

Perilipin 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Mouse MG52422-U
Perilipin 3 cDNA ORF Clone, Mouse, untagged MG52422-UT
Perilipin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52422-ACG
Perilipin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52422-ACGLN
Perilipin 3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52422-ANG
Perilipin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52422-ACR
Perilipin 3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52422-ANR
Perilipin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52422-CF
Perilipin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52422-NF
Perilipin 3 cDNA ORF Clone, Mouse, C-His tag MG52422-CH
Perilipin 3 cDNA ORF Clone, Mouse, N-His tag MG52422-NH
Perilipin 3 cDNA ORF Clone, Mouse, C-HA tag MG52422-CY
Perilipin 3 cDNA ORF Clone, Mouse, N-HA tag MG52422-NY
Perilipin 3 cDNA ORF Clone, Mouse, C-Myc tag MG52422-CM
Perilipin 3 cDNA ORF Clone, Mouse, N-Myc tag MG52422-NM
Perilipin 3 qPCR Primer Pairs, Mouse MP202295

Perilipin 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Perilipin 3 cDNA ORF Clone in Cloning Vector, Human HG14091-G
Perilipin 3 cDNA ORF Clone, Human, untagged HG14091-UT
Perilipin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14091-ACGLN
Perilipin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14091-ACG
Perilipin 3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14091-ANG
Perilipin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14091-ACR
Perilipin 3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14091-ANR
Perilipin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14091-CF
Perilipin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14091-NF
Perilipin 3 cDNA ORF Clone, Human, C-His tag HG14091-CH
Perilipin 3 cDNA ORF Clone, Human, N-His tag HG14091-NH
Perilipin 3 cDNA ORF Clone, Human, N-HA tag HG14091-NY
Perilipin 3 cDNA ORF Clone, Human, C-Myc tag HG14091-CM
Perilipin 3 cDNA ORF Clone, Human, N-Myc tag HG14091-NM
Perilipin 3 qPCR Primer Pairs, Human HP102744
info info
添加购物车成功! 添加购物车失败!