After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Pleckstrin / PLEK / p47 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PLEK cDNA Clone Product Information
NCBI RefSeq:BC018549
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Homo sapiens pleckstrin.
Gene Synonym:P47, PLEK
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Pleckstrin is a protein found in platelets. Pleckstrin is the source of the name pleckstrin homology domain. Pleckstrin homology domain (PH domain) is a protein domain of approximately 120 amino acids that occurs in a wide range of proteins involved in intracellular signaling or as constituents of the cytoskeleton. This domain can bind Phosphatidylinositol lipids within biological membranes (such as Phosphatidylinositol (3,4,5)-trisphosphate and phosphatidylinositol (4,5)-bisphosphate), and proteins such as the βγ-subunits of heterotrimeric G proteins, and protein kinase C. Through these interactions, PH domains play a role in recruiting proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways.

References
  • Ingley E, et al. (1994) Pleckstrin homology (PH) domains in signal transduction. J Cell Biochem. 56(4):436-43.
  • Gibson TJ, et al. (1994) PH domain: the first anniversary. Trends Biochem Sci. 19(9):349-53.
  • Haslam RJ, et al. (1993) Pleckstrin domain homology. Nature. 363(6427):309-10.
  • Size / Price
    Catalog: HG14401-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"