PLA2G2A cDNA ORF Clone, Human, C-HA tag

Cat: HG11187-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLA2G2A Reagents
CRO Services
Product recommended

All PLA2G2A Reagents
PLA2G2A cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
477 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 96G/C not causing the amino acid variation.
Description
Full length Clone DNA of Human phospholipase A2, group IIA (platelets, synovial fluid) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.48kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PLA2G2A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLA2G2A cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
PLA2G2A cDNA ORF Clone, Human, C-HA tag Alternative Names
MOM1 cDNA ORF Clone, Human;PLA2 cDNA ORF Clone, Human;PLA2B cDNA ORF Clone, Human;PLA2L cDNA ORF Clone, Human;PLA2S cDNA ORF Clone, Human;PLAS1 cDNA ORF Clone, Human;sPLA2 cDNA ORF Clone, Human
PLA2G2A Background Information

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

Full Name
phospholipase A2, group IIA (platelets, synovial fluid)
References
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • PLA2G2A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PLA2G2A cDNA ORF Clone in Cloning Vector, Mouse MG50203-G
    PLA2G2A cDNA ORF Clone, Mouse, untagged MG50203-UT
    PLA2G2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50203-ACGLN
    PLA2G2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50203-ACG
    PLA2G2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50203-ACR
    PLA2G2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50203-CF
    PLA2G2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50203-NF
    PLA2G2A cDNA ORF Clone, Mouse, C-His tag MG50203-CH
    PLA2G2A cDNA ORF Clone, Mouse, N-His tag MG50203-NH
    PLA2G2A cDNA ORF Clone, Mouse, C-HA tag MG50203-CY
    PLA2G2A cDNA ORF Clone, Mouse, N-HA tag MG50203-NY
    PLA2G2A cDNA ORF Clone, Mouse, C-Myc tag MG50203-CM
    PLA2G2A cDNA ORF Clone, Mouse, N-Myc tag MG50203-NM
    PLA2G2A qPCR Primer Pairs, Mouse MP200232

    PLA2G2A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PLA2G2A cDNA ORF Clone in Cloning Vector, Human HG11187-M
    PLA2G2A cDNA ORF Clone, Human, untagged HG11187-UT
    PLA2G2A cDNA ORF Clone, Human, C-GFPSpark® tag HG11187-ACG
    PLA2G2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11187-ACGLN
    PLA2G2A cDNA ORF Clone, Human, C-OFPSpark® tag HG11187-ACR
    PLA2G2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11187-CF
    PLA2G2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11187-NF
    PLA2G2A cDNA ORF Clone, Human, C-His tag HG11187-CH
    PLA2G2A cDNA ORF Clone, Human, N-His tag HG11187-NH
    PLA2G2A cDNA ORF Clone, Human, N-HA tag HG11187-NY
    PLA2G2A cDNA ORF Clone, Human, C-Myc tag HG11187-CM
    PLA2G2A cDNA ORF Clone, Human, N-Myc tag HG11187-NM
    PLA2G2A qPCR Primer Pairs, Human HP101093
    info info
    添加购物车成功! 添加购物车失败!