PKM2 cDNA ORF Clone, Human, C-OFPSpark® tag

Cat: HG11430-ACR

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PKM2 Reagents

CRO Services

Product recommended


All PKM2 Reagents

PKM2 cDNA ORF Clone, Human, C-OFPSpark® tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pyruvate kinase, muscle with C terminal OFPSpark / RFP tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 2.29kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PKM2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PKM2 cDNA ORF Clone, Human, C-OFPSpark® tag Validated Images

Human PKM2 Gene Expression validated Image 800
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
Human PKM2 Gene Expression validated Image 801
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
Human IL12A / IL-12A Gene Plasmid Map 5642

PKM2 cDNA ORF Clone, Human, C-OFPSpark® tag Alternative Names

CTHBP cDNA ORF Clone, Human;HEL-S-30 cDNA ORF Clone, Human;OIP3 cDNA ORF Clone, Human;PK3 cDNA ORF Clone, Human;PKM2 cDNA ORF Clone, Human;TCB cDNA ORF Clone, Human;THBP1 cDNA ORF Clone, Human

PKM2 Background Information

Pyruvate kinase isozymes M2 also known as pyruvate kinase muscle isozyme 2 (PKM2), pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1), or opa-interacting protein 3 (OIP3), is an isoenzyme of the glycolytic enzyme pyruvate kinase. Pyruvate kinase isozymes M2 / PKM2 is a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. PKM2 has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. PKM2 has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. PKM2 functions as a glycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. PKM2 may stimulates POU5F1-mediated transcriptional activation. This protein Plays a general role in caspase independent cell death of tumor cells. The ratio betwween the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms of PKM2 contributes to the control of glycolysis and is important for tumor cell proliferation and survival.
Full Name
pyruvate kinase, muscle
References
  • Bluemlein K, et al. (2011) No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2 (5): 393-400.
  • Gupta V, et al. (2010) Dominant Negative Mutations Affect Oligomerization of Human Pyruvate Kinase M2 Isozyme and Promote Cellular Growth and Polyploidy. J Biol Chem. 285 (22): 16864-73.
  • Eigenbrodt E, et al. (1992) Double role for pyruvate kinase type M2 in the expansion of phosphometabolite pools found in tumor cells. Crit Rev Oncog. 3 (1): 91-115.
  • PKM2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    PKM2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90521-G
    PKM2 cDNA ORF Clone, Cynomolgus, untagged CG90521-UT
    PKM2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90521-ACGLN
    PKM2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90521-ACG
    PKM2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90521-ANG
    PKM2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90521-ACR
    PKM2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90521-ANR
    PKM2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90521-CF
    PKM2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90521-NF
    PKM2 cDNA ORF Clone, Cynomolgus, C-His tag CG90521-CH
    PKM2 cDNA ORF Clone, Cynomolgus, N-His tag CG90521-NH
    PKM2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90521-CY
    PKM2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90521-NY
    PKM2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90521-CM
    PKM2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90521-NM

    PKM2 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    PKM2 cDNA ORF Clone in Cloning Vector, Rabbit TG65061-G
    PKM2 cDNA ORF Clone, Rabbit, untagged TG65061-UT
    PKM2 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65061-ACGLN
    PKM2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65061-ACG
    PKM2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65061-ANG
    PKM2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65061-ACR
    PKM2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65061-ANR
    PKM2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65061-CF
    PKM2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65061-NF
    PKM2 cDNA ORF Clone, Rabbit, C-His tag TG65061-CH
    PKM2 cDNA ORF Clone, Rabbit, N-His tag TG65061-NH
    PKM2 cDNA ORF Clone, Rabbit, C-HA tag TG65061-CY
    PKM2 cDNA ORF Clone, Rabbit, N-HA tag TG65061-NY
    PKM2 cDNA ORF Clone, Rabbit, C-Myc tag TG65061-CM
    PKM2 cDNA ORF Clone, Rabbit, N-Myc tag TG65061-NM

    PKM2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PKM2 cDNA ORF Clone in Cloning Vector, Rat RG80568-U
    PKM2 cDNA ORF Clone, Rat, untagged RG80568-UT
    PKM2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80568-ACG
    PKM2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80568-ACGLN
    PKM2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80568-ANG
    PKM2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80568-ACR
    PKM2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80568-ANR
    PKM2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80568-CF
    PKM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80568-NF
    PKM2 cDNA ORF Clone, Rat, C-His tag RG80568-CH
    PKM2 cDNA ORF Clone, Rat, N-His tag RG80568-NH
    PKM2 cDNA ORF Clone, Rat, C-HA tag RG80568-CY
    PKM2 cDNA ORF Clone, Rat, N-HA tag RG80568-NY
    PKM2 cDNA ORF Clone, Rat, C-Myc tag RG80568-CM
    PKM2 cDNA ORF Clone, Rat, N-Myc tag RG80568-NM
    PKM2 qPCR Primer Pairs, Rat RP300532

    PKM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PKM2 cDNA ORF Clone in Cloning Vector, Mouse MG53948-U
    PKM2 cDNA ORF Clone in Cloning Vector, Mouse MG51121-G
    PKM2 cDNA ORF Clone, Mouse, untagged MG53948-UT
    PKM2 cDNA ORF Clone, Mouse, untagged MG51121-UT
    PKM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51121-ACG
    PKM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53948-ACG
    PKM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51121-ACGLN
    PKM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53948-ACGLN
    PKM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51121-ANG
    PKM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53948-ANG
    PKM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51121-ACR
    PKM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53948-ACR
    PKM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53948-ANR
    PKM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51121-ANR
    PKM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53948-CF
    PKM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51121-CF
    PKM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53948-NF
    PKM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51121-NF
    PKM2 cDNA ORF Clone, Mouse, C-His tag MG53948-CH
    PKM2 cDNA ORF Clone, Mouse, C-His tag MG51121-CH
    PKM2 cDNA ORF Clone, Mouse, N-His tag MG53948-NH
    PKM2 cDNA ORF Clone, Mouse, N-His tag MG51121-NH
    PKM2 cDNA ORF Clone, Mouse, C-HA tag MG53948-CY
    PKM2 cDNA ORF Clone, Mouse, C-HA tag MG51121-CY
    PKM2 cDNA ORF Clone, Mouse, N-HA tag MG51121-NY
    PKM2 cDNA ORF Clone, Mouse, N-HA tag MG53948-NY
    PKM2 cDNA ORF Clone, Mouse, C-Myc tag MG51121-CM
    PKM2 cDNA ORF Clone, Mouse, C-Myc tag MG53948-CM
    PKM2 cDNA ORF Clone, Mouse, N-Myc tag MG51121-NM
    PKM2 cDNA ORF Clone, Mouse, N-Myc tag MG53948-NM

    PKM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PKM2 cDNA ORF Clone in Cloning Vector, Human HG16269-G
    PKM2 cDNA ORF Clone in Cloning Vector, Human HG11430-M
    PKM2 cDNA ORF Clone, Human, untagged HG11430-UT
    PKM2 cDNA ORF Clone, Human, untagged HG16269-UT
    PKM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16269-ACG
    PKM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11430-ACGLN
    PKM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11430-ACG
    PKM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16269-ACGLN
    PKM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16269-ANG
    PKM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11430-ANG
    PKM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16269-ACR
    PKM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11430-ANR
    PKM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16269-ANR
    PKM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16269-CF
    PKM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11430-CF
    PKM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11430-NF
    PKM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16269-NF
    PKM2 cDNA ORF Clone, Human, C-His tag HG11430-CH
    PKM2 cDNA ORF Clone, Human, C-His tag HG16269-CH
    PKM2 cDNA ORF Clone, Human, N-His tag HG16269-NH
    PKM2 cDNA ORF Clone, Human, N-His tag HG11430-NH
    PKM2 cDNA ORF Clone, Human, C-HA tag HG11430-CY
    PKM2 cDNA ORF Clone, Human, C-HA tag HG16269-CY
    PKM2 cDNA ORF Clone, Human, N-HA tag HG11430-NY
    PKM2 cDNA ORF Clone, Human, N-HA tag HG16269-NY
    PKM2 cDNA ORF Clone, Human, C-Myc tag HG11430-CM
    PKM2 cDNA ORF Clone, Human, C-Myc tag HG16269-CM
    PKM2 cDNA ORF Clone, Human, N-Myc tag HG11430-NM
    PKM2 cDNA ORF Clone, Human, N-Myc tag HG16269-NM
    PKM2 qPCR Primer Pairs, Human HP101307
    info info
    添加购物车成功! 添加购物车失败!