Quick Order

Human PKM2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

  • Human PKM2 natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
  • Human PKM2 natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
  • Human PKM2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tag
DatasheetReviewsRelated ProductsProtocols
Human PKM cDNA Clone Product Information
NCBI RefSeq:NM_002654.3
RefSeq ORF Size:1596bp
cDNA Description:Full length Clone DNA of Homo sapiens pyruvate kinase, muscle with C terminal OFPSpark / RFP tag.
Gene Synonym:PK3, PKM, TCB, OIP3, CTHBP, THBP1, MGC3932, PKM2
Species:Human
Vector:pCMV3-C-OFPSpark
Plasmid:pCMV3-PKM-OFPSpark
Restriction Site:KpnI + NotI (6kb + 2.29kb)
Tag Sequence:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PKM qPCR primers for gene expression analysis, HP101307 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PKM Gene Plasmid Map
Human PKM2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tag
Human PKM Gene Expression validated Image
Human PKM2 natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
Human PKM2 natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
OFP (OFPSpark) / RFP Tag Info

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Product nameProduct name
Background

Pyruvate kinase isozymes M2 also known as pyruvate kinase muscle isozyme 2 (PKM2), pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1), or opa-interacting protein 3 (OIP3), is an isoenzyme of the glycolytic enzyme pyruvate kinase. Pyruvate kinase isozymes M2 / PKM2 is a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. PKM2 has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. PKM2 has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. PKM2 functions as a glycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. PKM2 may stimulates POU5F1-mediated transcriptional activation. This protein Plays a general role in caspase independent cell death of tumor cells. The ratio betwween the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms of PKM2 contributes to the control of glycolysis and is important for tumor cell proliferation and survival.

References
  • Bluemlein K, et al. (2011) No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2 (5): 393-400.
  • Gupta V, et al. (2010) Dominant Negative Mutations Affect Oligomerization of Human Pyruvate Kinase M2 Isozyme and Promote Cellular Growth and Polyploidy. J Biol Chem. 285 (22): 16864-73.
  • Eigenbrodt E, et al. (1992) Double role for pyruvate kinase type M2 in the expansion of phosphometabolite pools found in tumor cells. Crit Rev Oncog. 3 (1): 91-115.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"