PKC delta cDNA ORF Clone, Human, N-His tag

Cat: HG10769-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PKC delta Reagents
CRO Services
Product recommended

All PKC delta Reagents
PKC delta cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2031 bp
Description
Full length Clone DNA of Human protein kinase C, delta with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PKC delta cDNA ORF Clone, Human, N-His tag Alternative Names
42125 cDNA ORF Clone, Human;ALPS3 cDNA ORF Clone, Human;CVID9 cDNA ORF Clone, Human;nPKC-delta cDNA ORF Clone, Human;PKCD cDNA ORF Clone, Human
PKC delta Background Information
Full Name
protein kinase C, delta
References
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • PKC delta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PKC delta cDNA ORF Clone in Cloning Vector, Mouse MG50345-M
    PKC delta cDNA ORF Clone, Mouse, untagged MG50345-UT
    PKC delta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50345-ACG
    PKC delta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50345-ACGLN
    PKC delta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50345-ANG
    PKC delta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50345-ACR
    PKC delta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50345-ANR
    PKC delta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50345-CF
    PKC delta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50345-NF
    PKC delta cDNA ORF Clone, Mouse, C-His tag MG50345-CH
    PKC delta cDNA ORF Clone, Mouse, N-His tag MG50345-NH
    PKC delta cDNA ORF Clone, Mouse, C-HA tag MG50345-CY
    PKC delta cDNA ORF Clone, Mouse, N-HA tag MG50345-NY
    PKC delta cDNA ORF Clone, Mouse, C-Myc tag MG50345-CM
    PKC delta cDNA ORF Clone, Mouse, N-Myc tag MG50345-NM
    PKC delta qPCR Primer Pairs, Mouse MP200367

    PKC delta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PKC delta cDNA ORF Clone in Cloning Vector, Human HG10769-M
    PKC delta cDNA ORF Clone, Human, untagged HG10769-UT
    PKC delta cDNA ORF Clone, Human, C-GFPSpark® tag HG10769-ACG
    PKC delta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10769-ACGLN
    PKC delta cDNA ORF Clone, Human, N-GFPSpark® tag HG10769-ANG
    PKC delta cDNA ORF Clone, Human, C-OFPSpark® tag HG10769-ACR
    PKC delta cDNA ORF Clone, Human, N-OFPSpark® tag HG10769-ANR
    PKC delta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10769-CF
    PKC delta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10769-NF
    PKC delta cDNA ORF Clone, Human, C-His tag HG10769-CH
    PKC delta cDNA ORF Clone, Human, C-HA tag HG10769-CY
    PKC delta cDNA ORF Clone, Human, N-HA tag HG10769-NY
    PKC delta cDNA ORF Clone, Human, C-Myc tag HG10769-CM
    PKC delta cDNA ORF Clone, Human, N-Myc tag HG10769-NM
    PKC delta qPCR Primer Pairs, Human HP100905
    info info
    添加购物车成功! 添加购物车失败!