PIPOX cDNA ORF Clone, Human, N-HA tag

Cat: HG14757-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PIPOX Reagents
CRO Services
Product recommended

All PIPOX Reagents
PIPOX cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Human pipecolic acid oxidase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIPOX cDNA ORF Clone, Human, N-HA tag Alternative Names
LPIPOX cDNA ORF Clone, Human
PIPOX Background Information
Full Name
pipecolic acid oxidase

PIPOX cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIPOX cDNA ORF Clone in Cloning Vector, Mouse MG5A3511-U
PIPOX cDNA ORF Clone, Mouse, untagged MG5A3511-UT
PIPOX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3511-ACG
PIPOX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3511-ACGLN
PIPOX cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3511-ANG
PIPOX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3511-ACR
PIPOX cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3511-ANR
PIPOX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3511-CF
PIPOX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3511-NF
PIPOX cDNA ORF Clone, Mouse, C-His tag MG5A3511-CH
PIPOX cDNA ORF Clone, Mouse, N-His tag MG5A3511-NH
PIPOX cDNA ORF Clone, Mouse, C-HA tag MG5A3511-CY
PIPOX cDNA ORF Clone, Mouse, N-HA tag MG5A3511-NY
PIPOX cDNA ORF Clone, Mouse, C-Myc tag MG5A3511-CM
PIPOX cDNA ORF Clone, Mouse, N-Myc tag MG5A3511-NM

PIPOX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIPOX cDNA ORF Clone in Cloning Vector, Human HG14757-G
PIPOX cDNA ORF Clone, Human, untagged HG14757-UT
PIPOX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14757-ACGLN
PIPOX cDNA ORF Clone, Human, C-GFPSpark® tag HG14757-ACG
PIPOX cDNA ORF Clone, Human, N-GFPSpark® tag HG14757-ANG
PIPOX cDNA ORF Clone, Human, C-OFPSpark® tag HG14757-ACR
PIPOX cDNA ORF Clone, Human, N-OFPSpark® tag HG14757-ANR
PIPOX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14757-CF
PIPOX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14757-NF
PIPOX cDNA ORF Clone, Human, C-His tag HG14757-CH
PIPOX cDNA ORF Clone, Human, N-His tag HG14757-NH
PIPOX cDNA ORF Clone, Human, C-HA tag HG14757-CY
PIPOX cDNA ORF Clone, Human, C-Myc tag HG14757-CM
PIPOX cDNA ORF Clone, Human, N-Myc tag HG14757-NM
PIPOX qPCR Primer Pairs, Human HP103390
info info
添加购物车成功! 添加购物车失败!