PIK3R4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10656-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PIK3R4 Reagents
CRO Services
Product recommended

All PIK3R4 Reagents
PIK3R4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4077 bp
Description
Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIK3R4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
p150 cDNA ORF Clone, Human;VPS15 cDNA ORF Clone, Human
PIK3R4 Background Information
Full Name
phosphoinositide-3-kinase, regulatory subunit 4

PIK3R4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIK3R4 cDNA ORF Clone in Cloning Vector, Mouse MG50905-G
PIK3R4 cDNA ORF Clone, Mouse, untagged MG50905-UT
PIK3R4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50905-ACGLN
PIK3R4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50905-ACG
PIK3R4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50905-ANG
PIK3R4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50905-ACR
PIK3R4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50905-ANR
PIK3R4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50905-CF
PIK3R4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50905-NF
PIK3R4 cDNA ORF Clone, Mouse, C-His tag MG50905-CH
PIK3R4 cDNA ORF Clone, Mouse, N-His tag MG50905-NH
PIK3R4 cDNA ORF Clone, Mouse, C-HA tag MG50905-CY
PIK3R4 cDNA ORF Clone, Mouse, N-HA tag MG50905-NY
PIK3R4 cDNA ORF Clone, Mouse, C-Myc tag MG50905-CM
PIK3R4 cDNA ORF Clone, Mouse, N-Myc tag MG50905-NM
PIK3R4 qPCR Primer Pairs, Mouse MP200876

PIK3R4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIK3R4 cDNA ORF Clone in Cloning Vector, Human HG10656-M
PIK3R4 cDNA ORF Clone, Human, untagged HG10656-UT
PIK3R4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10656-ACG
PIK3R4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10656-ACGLN
PIK3R4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10656-ANG
PIK3R4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10656-ACR
PIK3R4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10656-ANR
PIK3R4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10656-CF
PIK3R4 cDNA ORF Clone, Human, C-His tag HG10656-CH
PIK3R4 cDNA ORF Clone, Human, N-His tag HG10656-NH
PIK3R4 cDNA ORF Clone, Human, C-HA tag HG10656-CY
PIK3R4 cDNA ORF Clone, Human, N-HA tag HG10656-NY
PIK3R4 cDNA ORF Clone, Human, C-Myc tag HG10656-CM
PIK3R4 cDNA ORF Clone, Human, N-Myc tag HG10656-NM
PIK3R4 qPCR Primer Pairs, Human HP100871
info info
添加购物车成功! 添加购物车失败!