PIGR cDNA ORF Clone, Human, N-His tag

Cat: HG10131-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PIGR Reagents
CRO Services
Product recommended

All PIGR Reagents
PIGR cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2295 bp
Description
Full length Clone DNA of Human polymeric immunoglobulin receptor with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIGR cDNA ORF Clone, Human, N-His tag Alternative Names
FLJ22667 cDNA ORF Clone, Human;MGC125361 cDNA ORF Clone, Human;MGC125362 cDNA ORF Clone, Human;PIGR cDNA ORF Clone, Human
PIGR Background Information

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

Full Name
polymeric immunoglobulin receptor
References
  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • PIGR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PIGR cDNA ORF Clone in Cloning Vector, Mouse MG50119-M
    PIGR cDNA ORF Clone, Mouse, untagged MG50119-UT
    PIGR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50119-ACG
    PIGR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50119-ACGLN
    PIGR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50119-ACR
    PIGR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50119-CF
    PIGR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50119-NF
    PIGR cDNA ORF Clone, Mouse, C-His tag MG50119-CH
    PIGR cDNA ORF Clone, Mouse, N-His tag MG50119-NH
    PIGR cDNA ORF Clone, Mouse, C-HA tag MG50119-CY
    PIGR cDNA ORF Clone, Mouse, N-HA tag MG50119-NY
    PIGR cDNA ORF Clone, Mouse, C-Myc tag MG50119-CM
    PIGR cDNA ORF Clone, Mouse, N-Myc tag MG50119-NM
    PIGR qPCR Primer Pairs, Mouse MP200149

    PIGR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PIGR cDNA ORF Clone in Cloning Vector, Human HG10131-M
    PIGR cDNA ORF Clone, Human, untagged HG10131-UT
    PIGR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10131-ACGLN
    PIGR cDNA ORF Clone, Human, C-GFPSpark® tag HG10131-ACG
    PIGR cDNA ORF Clone, Human, C-OFPSpark® tag HG10131-ACR
    PIGR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10131-CF
    PIGR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10131-NF
    PIGR cDNA ORF Clone, Human, C-His tag HG10131-CH
    PIGR cDNA ORF Clone, Human, C-HA tag HG10131-CY
    PIGR cDNA ORF Clone, Human, N-HA tag HG10131-NY
    PIGR cDNA ORF Clone, Human, C-Myc tag HG10131-CM
    PIGR cDNA ORF Clone, Human, N-Myc tag HG10131-NM
    PIGR qPCR Primer Pairs, Human HP100203
    info info
    添加购物车成功! 添加购物车失败!