PIAS1 cDNA ORF Clone, Human, N-His tag

Cat: HG15957-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PIAS1 Reagents
CRO Services
Product recommended

All PIAS1 Reagents
PIAS1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1956 bp
Description
Full length Clone DNA of Human protein inhibitor of activated STAT, 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIAS1 cDNA ORF Clone, Human, N-His tag Alternative Names
DDXBP1 cDNA ORF Clone, Human;GBP cDNA ORF Clone, Human;GU/RH-II cDNA ORF Clone, Human;ZMIZ3 cDNA ORF Clone, Human
PIAS1 Background Information
Full Name
protein inhibitor of activated STAT, 1

PIAS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIAS1 cDNA ORF Clone in Cloning Vector, Mouse MG52942-G
PIAS1 cDNA ORF Clone, Mouse, untagged MG52942-UT
PIAS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52942-ACG
PIAS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52942-ACGLN
PIAS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52942-ANG
PIAS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52942-ACR
PIAS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52942-ANR
PIAS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52942-CF
PIAS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52942-NF
PIAS1 cDNA ORF Clone, Mouse, C-His tag MG52942-CH
PIAS1 cDNA ORF Clone, Mouse, N-His tag MG52942-NH
PIAS1 cDNA ORF Clone, Mouse, C-HA tag MG52942-CY
PIAS1 cDNA ORF Clone, Mouse, N-HA tag MG52942-NY
PIAS1 cDNA ORF Clone, Mouse, C-Myc tag MG52942-CM
PIAS1 cDNA ORF Clone, Mouse, N-Myc tag MG52942-NM

PIAS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIAS1 cDNA ORF Clone in Cloning Vector, Human HG15957-G
PIAS1 cDNA ORF Clone, Human, untagged HG15957-UT
PIAS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15957-ACG
PIAS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15957-ACGLN
PIAS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15957-ANG
PIAS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15957-ACR
PIAS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15957-ANR
PIAS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15957-CF
PIAS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15957-NF
PIAS1 cDNA ORF Clone, Human, C-His tag HG15957-CH
PIAS1 cDNA ORF Clone, Human, C-HA tag HG15957-CY
PIAS1 cDNA ORF Clone, Human, N-HA tag HG15957-NY
PIAS1 cDNA ORF Clone, Human, C-Myc tag HG15957-CM
PIAS1 cDNA ORF Clone, Human, N-Myc tag HG15957-NM
PIAS1 qPCR Primer Pairs, Human HP104544
info info
添加购物车成功! 添加购物车失败!