Quick Order

Human C12orf53 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human PIANP cDNA Clone Product Information
NCBI RefSeq:BC035736
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens PILR alpha associated neural protein with N terminal Myc tag.
Gene Synonym:PANP, C12orf53
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

C12orf53 is mainly expressed in adult brain and cerebellum. It also can be detected in fetal brain and virtually no expression in spleen, heart, kidney, liver and dorsal ganglion relative to brain. C12orf53 acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. Chromosome 12 encodes over 1,100 genes within 132 million bases. A number of skeletal deformities are linked to chromosome 12 including hypochondrogenesis, achondrogenesis and Kniest dysplasia. Noonan syndrome, which includes heart and facial developmental defects among the primary symptoms, is caused by a mutant form of PTPN11 gene product, SH-PTP2. Chromosome 12 is also home to a homeobox gene cluster which encodes crucial transcription factors for morphogenesis, and the natural killer complex gene cluster encoding C-type lectin proteins which mediate the NK cell response to MHC class I interaction.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Tissue Antigens. Nat Genet. 36(1):40-5.
  • Kogure A, et al. (2011) PANP is a novel O-glycosylated PILR ligand expressed in neural tissues. Biochem Biophys Res Commun. 405(3):428-33.
  • Size / Price
    Catalog: HG13238-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"