PHYHIP cDNA ORF Clone, Human, C-His tag

Cat: HG14723-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PHYHIP Reagents
CRO Services
Product recommended

All PHYHIP Reagents
PHYHIP cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Human phytanoyl-CoA 2-hydroxylase interacting protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PHYHIP cDNA ORF Clone, Human, C-His tag Alternative Names
DYRK1AP3 cDNA ORF Clone, Human;PAHX-AP cDNA ORF Clone, Human;PAHXAP1 cDNA ORF Clone, Human
PHYHIP Background Information
Full Name
phytanoyl-CoA 2-hydroxylase interacting protein

PHYHIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PHYHIP cDNA ORF Clone in Cloning Vector, Mouse MG51736-G
PHYHIP cDNA ORF Clone, Mouse, untagged MG51736-UT
PHYHIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51736-ACGLN
PHYHIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51736-ACG
PHYHIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51736-ANG
PHYHIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51736-ACR
PHYHIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51736-ANR
PHYHIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51736-CF
PHYHIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51736-NF
PHYHIP cDNA ORF Clone, Mouse, C-His tag MG51736-CH
PHYHIP cDNA ORF Clone, Mouse, N-His tag MG51736-NH
PHYHIP cDNA ORF Clone, Mouse, C-HA tag MG51736-CY
PHYHIP cDNA ORF Clone, Mouse, N-HA tag MG51736-NY
PHYHIP cDNA ORF Clone, Mouse, C-Myc tag MG51736-CM
PHYHIP cDNA ORF Clone, Mouse, N-Myc tag MG51736-NM
PHYHIP qPCR Primer Pairs, Mouse MP201609

PHYHIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PHYHIP cDNA ORF Clone in Cloning Vector, Human HG14723-G
PHYHIP cDNA ORF Clone, Human, untagged HG14723-UT
PHYHIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14723-ACGLN
PHYHIP cDNA ORF Clone, Human, C-GFPSpark® tag HG14723-ACG
PHYHIP cDNA ORF Clone, Human, N-GFPSpark® tag HG14723-ANG
PHYHIP cDNA ORF Clone, Human, C-OFPSpark® tag HG14723-ACR
PHYHIP cDNA ORF Clone, Human, N-OFPSpark® tag HG14723-ANR
PHYHIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14723-CF
PHYHIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14723-NF
PHYHIP cDNA ORF Clone, Human, N-His tag HG14723-NH
PHYHIP cDNA ORF Clone, Human, C-HA tag HG14723-CY
PHYHIP cDNA ORF Clone, Human, N-HA tag HG14723-NY
PHYHIP cDNA ORF Clone, Human, C-Myc tag HG14723-CM
PHYHIP cDNA ORF Clone, Human, N-Myc tag HG14723-NM
PHYHIP qPCR Primer Pairs, Human HP103356
info info
添加购物车成功! 添加购物车失败!