PHYH cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13368-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PHYH Reagents
CRO Services
Product recommended

All PHYH Reagents
PHYH cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1017 bp
Description
Full length Clone DNA of Human phytanoyl-CoA 2-hydroxylase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PHYH cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
LN1 cDNA ORF Clone, Human;LNAP1 cDNA ORF Clone, Human;PAHX cDNA ORF Clone, Human;PHYH1 cDNA ORF Clone, Human;RD cDNA ORF Clone, Human
PHYH Background Information

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

Full Name
phytanoyl-CoA 2-hydroxylase
References
  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • PHYH cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PHYH cDNA ORF Clone in Cloning Vector, Rat RG80681-U
    PHYH cDNA ORF Clone, Rat, untagged RG80681-UT
    PHYH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80681-ACGLN
    PHYH cDNA ORF Clone, Rat, C-GFPSpark® tag RG80681-ACG
    PHYH cDNA ORF Clone, Rat, N-GFPSpark® tag RG80681-ANG
    PHYH cDNA ORF Clone, Rat, C-OFPSpark® tag RG80681-ACR
    PHYH cDNA ORF Clone, Rat, N-OFPSpark® tag RG80681-ANR
    PHYH cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80681-CF
    PHYH cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80681-NF
    PHYH cDNA ORF Clone, Rat, C-His tag RG80681-CH
    PHYH cDNA ORF Clone, Rat, N-His tag RG80681-NH
    PHYH cDNA ORF Clone, Rat, C-HA tag RG80681-CY
    PHYH cDNA ORF Clone, Rat, N-HA tag RG80681-NY
    PHYH cDNA ORF Clone, Rat, C-Myc tag RG80681-CM
    PHYH cDNA ORF Clone, Rat, N-Myc tag RG80681-NM
    PHYH qPCR Primer Pairs, Rat RP300645

    PHYH cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PHYH cDNA ORF Clone in Cloning Vector, Mouse MG5A0786-U
    PHYH cDNA ORF Clone, Mouse, untagged MG5A0786-UT
    PHYH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0786-ACGLN
    PHYH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0786-ACG
    PHYH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0786-ANG
    PHYH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0786-ACR
    PHYH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0786-ANR
    PHYH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0786-CF
    PHYH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0786-NF
    PHYH cDNA ORF Clone, Mouse, C-His tag MG5A0786-CH
    PHYH cDNA ORF Clone, Mouse, N-His tag MG5A0786-NH
    PHYH cDNA ORF Clone, Mouse, C-HA tag MG5A0786-CY
    PHYH cDNA ORF Clone, Mouse, N-HA tag MG5A0786-NY
    PHYH cDNA ORF Clone, Mouse, C-Myc tag MG5A0786-CM
    PHYH cDNA ORF Clone, Mouse, N-Myc tag MG5A0786-NM

    PHYH cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PHYH cDNA ORF Clone in Cloning Vector, Human HG13368-G
    PHYH cDNA ORF Clone, Human, untagged HG13368-UT
    PHYH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13368-ACGLN
    PHYH cDNA ORF Clone, Human, C-GFPSpark® tag HG13368-ACG
    PHYH cDNA ORF Clone, Human, N-GFPSpark® tag HG13368-ANG
    PHYH cDNA ORF Clone, Human, C-OFPSpark® tag HG13368-ACR
    PHYH cDNA ORF Clone, Human, N-OFPSpark® tag HG13368-ANR
    PHYH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13368-NF
    PHYH cDNA ORF Clone, Human, C-His tag HG13368-CH
    PHYH cDNA ORF Clone, Human, N-His tag HG13368-NH
    PHYH cDNA ORF Clone, Human, C-HA tag HG13368-CY
    PHYH cDNA ORF Clone, Human, N-HA tag HG13368-NY
    PHYH cDNA ORF Clone, Human, C-Myc tag HG13368-CM
    PHYH cDNA ORF Clone, Human, N-Myc tag HG13368-NM
    PHYH qPCR Primer Pairs, Human HP102073
    info info
    添加购物车成功! 添加购物车失败!