Quick Order

Text Size:AAA

Human PHYH Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PHYH cDNA Clone Product Information
NCBI RefSeq:BC029512
RefSeq ORF Size:1017bp
cDNA Description:Full length Clone DNA of Homo sapiens phytanoyl-CoA 2-hydroxylase.
Gene Synonym:RD, LN1, PAHX, LNAP1, PHYH1, PHYH
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

References
  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • Size / Price
    Catalog: HG13368-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"