Quick Order

Human PGLYRP1/PGRP-S Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PGLYRP1 cDNA Clone Product Information
NCBI RefSeq:NM_005091.1
RefSeq ORF Size:591bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidoglycan recognition protein 1 (PGLYRP1) with C terminal Flag tag.
Gene Synonym:PGRP, TAG7, PGRPS, PGLYRP, PGRP-S, TNFSF3L, MGC126894, MGC126896, PGLYRP1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Mouse Peptidoglycan recognition protein 1, also known as Peptidoglycan recognition protein short, PGRP-S, PGLYRP1, PGLYRP, PGRP and TNFSF3L, is a secreted protein which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. PGLYRP1 / PGLYRP is highly expressed in bone marrow. It is weakly expressed in kidney, liver, small intestine, spleen, thymus, peripheral leukocyte, lung, fetal spleen and neutrophils. PGLYRP1 / PGLYRP is a pattern receptor that binds to murein peptidoglycans (PGN) of Gram-positive bacteria. It has bactericidal activity towards Gram-positive bacteria. PGLYRP1 / PGLYRP may kill Gram-positive bacteria by interfering with peptidoglycan biosynthesis. It binds also to Gram-negative bacteria, and has bacteriostatic activity towards Gram-negative bacteria.

Peptidoglycan recognition proteins ( PGRPs or PGLYRPs ) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs: PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4. They are secreted proteins expressed in polymorphonuclear leukocytes ( PGLYRP1 ), liver ( PGLYRP2 ), or on body surfaces, mucous membranes, and in secretions (saliva, sweat) (PGLYRP3 and PGLYRP4). All PGRPs recognize bacterial peptidoglycan. The PGRPs likely play a role both in antibacterial defenses and several inflammatory diseases. They modulate local inflammatory responses in tissues (such as arthritic joints) and there is evidence for association of PGRPs with inflammatory diseases, such as psoriasis.

Size / Price
Catalog: HG10403-CF
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"