PGF cDNA ORF Clone, Human, N-Myc tag

Cat: HG10274-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PGF Reagents
CRO Services
Product recommended

All PGF Reagents
PGF cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
513 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human placental growth factor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
HindIII+XbaI (6kb+0.55kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PGF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGF cDNA ORF Clone, Human, N-Myc tag Validated Images
Human HER2/ERBB2 Gene Plasmid Map 5632
PGF cDNA ORF Clone, Human, N-Myc tag Alternative Names
D12S1900 cDNA ORF Clone, Human;PGFL cDNA ORF Clone, Human;PLGF cDNA ORF Clone, Human;PlGF-2 cDNA ORF Clone, Human;SHGC-10760 cDNA ORF Clone, Human
PGF Background Information
Full Name
placental growth factor
References
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PLGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placental growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • PGF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PGF cDNA ORF Clone in Cloning Vector, Mouse MG50125-M
    PGF cDNA ORF Clone, Mouse, untagged MG50125-UT
    PGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50125-ACG
    PGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50125-ACGLN
    PGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50125-ACR
    PGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50125-CF
    PGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50125-NF
    PGF cDNA ORF Clone, Mouse, C-His tag MG50125-CH
    PGF cDNA ORF Clone, Mouse, N-His tag MG50125-NH
    PGF cDNA ORF Clone, Mouse, C-HA tag MG50125-CY
    PGF cDNA ORF Clone, Mouse, N-HA tag MG50125-NY
    PGF cDNA ORF Clone, Mouse, C-Myc tag MG50125-CM
    PGF cDNA ORF Clone, Mouse, N-Myc tag MG50125-NM
    PGF qPCR Primer Pairs, Mouse MP200155

    PGF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PGF cDNA ORF Clone in Cloning Vector, Human HG10274-M
    PGF cDNA ORF Clone, Human, untagged HG10274-UT
    PGF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10274-ACGLN
    PGF cDNA ORF Clone, Human, C-GFPSpark® tag HG10274-ACG
    PGF cDNA ORF Clone, Human, C-OFPSpark® tag HG10274-ACR
    PGF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10274-CF
    PGF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10274-NF
    PGF cDNA ORF Clone, Human, C-His tag HG10274-CH
    PGF cDNA ORF Clone, Human, N-His tag HG10274-NH
    PGF cDNA ORF Clone, Human, C-HA tag HG10274-CY
    PGF cDNA ORF Clone, Human, N-HA tag HG10274-NY
    PGF cDNA ORF Clone, Human, C-Myc tag HG10274-CM
    PGF qPCR Primer Pairs, Human HP100321
    info info
    添加购物车成功! 添加购物车失败!