Quick Order

Human PGAM1 natural ORF mammalian expression plasmid

Datasheet Reviews Related Products Protocols
Human PGAM1 cDNA Clone Product Information
NCBI RefSeq:BC157873.1
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphoglycerate mutase 1 (brain).
Gene Synonym:PGAMA, PGAM-B, HEL-S-35
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog:  HG16274-UT
List Price:    (Save )
Price:       [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"