PGA4 cDNA ORF Clone, Human, N-His tag

Cat: HG13082-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PGA4 Reagents
CRO Services
Product recommended

All PGA4 Reagents
PGA4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pepsinogen 4, group I (pepsinogen A) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI (6kb + 1.17kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PGA4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGA4 cDNA ORF Clone, Human, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
PGA4 cDNA ORF Clone, Human, N-His tag Alternative Names
FLJ58952 cDNA ORF Clone, Human;FLJ77962 cDNA ORF Clone, Human;PGA3 cDNA ORF Clone, Human;PGA4 cDNA ORF Clone, Human;PGA5 cDNA ORF Clone, Human
PGA4 Background Information

PGA4 (Pepsinogen 4, group I), or Pepsinogen A, is a member of the peptidase A1 family. Pepsin is expressed as a pro-form zymogen, pepsinogen, whose primary structure has an additional 44 amino acids. Pepsin is stored as pepsinogen so it will only be released when needed, and does not digest the body's own proteins in the stomach's lining. Five types of zymogens of pepsins, gastric digestive proteinases, are known: pepsinogens A, B, and F, progastricsin, and prochymosin. There are two major groups of pepsinogen, namely pepsinogen A (PGA) and pepsinogen C (PGC) (or progastricsin), and each frequently has isozymogens. The PGA3, PGA4 and PGA5 genes encode identical human pepsinogen A enzymes.

Full Name
pepsinogen 4, group I (pepsinogen A)
References
  • Kageyama T. (2002) Pepsinogens, progastricsins, and prochymosins: structure, function, evolution, and development. Cell Mol Life Sci. 59(2): 288-306.
  • Takahashi K. (1992) Gene structures of pepsinogens A and C. Scand J Clin Lab Invest Suppl. 210: 97-110.
  • info info
    添加购物车成功! 添加购物车失败!