PFN1/Profilin 1 cDNA ORF Clone, Human, untagged

Cat: HG14329-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PFN1/Profilin 1 Reagents
CRO Services
Product recommended

All PFN1/Profilin 1 Reagents
PFN1/Profilin 1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Human profilin 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFN1/Profilin 1 cDNA ORF Clone, Human, untagged Alternative Names
ALS18 cDNA ORF Clone, Human
PFN1/Profilin 1 Background Information
Full Name
profilin 1

PFN1/Profilin 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PFN1/Profilin 1 cDNA ORF Clone in Cloning Vector, Rat RG81296-U
PFN1/Profilin 1 cDNA ORF Clone, Rat, untagged RG81296-UT
PFN1/Profilin 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81296-ACGLN
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81296-ACG
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81296-ANG
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81296-ACR
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81296-ANR
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81296-CF
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81296-NF
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-His tag RG81296-CH
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-His tag RG81296-NH
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-HA tag RG81296-CY
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-HA tag RG81296-NY
PFN1/Profilin 1 cDNA ORF Clone, Rat, C-Myc tag RG81296-CM
PFN1/Profilin 1 cDNA ORF Clone, Rat, N-Myc tag RG81296-NM
PFN1/Profilin 1 qPCR Primer Pairs, Rat RP301252

PFN1/Profilin 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PFN1/Profilin 1 cDNA ORF Clone in Cloning Vector, Mouse MG52800-G
PFN1/Profilin 1 cDNA ORF Clone, Mouse, untagged MG52800-UT
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52800-ACG
PFN1/Profilin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52800-ACGLN
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52800-ACR
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52800-CF
PFN1/Profilin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52800-NF
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-His tag MG52800-CH
PFN1/Profilin 1 cDNA ORF Clone, Mouse, N-His tag MG52800-NH
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-HA tag MG52800-CY
PFN1/Profilin 1 cDNA ORF Clone, Mouse, N-HA tag MG52800-NY
PFN1/Profilin 1 cDNA ORF Clone, Mouse, C-Myc tag MG52800-CM
PFN1/Profilin 1 cDNA ORF Clone, Mouse, N-Myc tag MG52800-NM

PFN1/Profilin 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PFN1/Profilin 1 cDNA ORF Clone in Cloning Vector, Human HG14329-G
PFN1/Profilin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14329-ACGLN
PFN1/Profilin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14329-ACG
PFN1/Profilin 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14329-ANG
PFN1/Profilin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14329-ACR
PFN1/Profilin 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14329-ANR
PFN1/Profilin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14329-CF
PFN1/Profilin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14329-NF
PFN1/Profilin 1 cDNA ORF Clone, Human, C-His tag HG14329-CH
PFN1/Profilin 1 cDNA ORF Clone, Human, N-His tag HG14329-NH
PFN1/Profilin 1 cDNA ORF Clone, Human, C-HA tag HG14329-CY
PFN1/Profilin 1 cDNA ORF Clone, Human, N-HA tag HG14329-NY
PFN1/Profilin 1 cDNA ORF Clone, Human, C-Myc tag HG14329-CM
PFN1/Profilin 1 cDNA ORF Clone, Human, N-Myc tag HG14329-NM
PFN1/Profilin 1 qPCR Primer Pairs, Human HP102979
info info
添加购物车成功! 添加购物车失败!