PFKFB3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13230-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PFKFB3 Reagents
CRO Services
Product recommended

All PFKFB3 Reagents
PFKFB3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1563 bp
Description
Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFKFB3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
IPFK2 cDNA ORF Clone, Human;PFK2 cDNA ORF Clone, Human
PFKFB3 Background Information

Fructose-2,6-biphosphatase 3, also known as 6-phosphofructo-2-kinase or PFK2 or PFKFB3, is a potent activator of phosphofructokinase, which is a rate-limiting enzyme of glycolysis. Highly phosphorylated PFKFB3 protein was found in human tumor cells, vascular endothelial cells, and smooth muscle cells. Fructose 2,6-bisphosphate (Fru-2,6-BP) is an allosteric activator of 6-phosphofructo-1-kinase (PFK-1), a rate-limiting enzyme and essential control point in glycolysis. The concentration of PFK2 depends on the activity of the bifunctional enzyme, 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK-2 / FBPase). PFK2 controls the glycolytic flux via the allosteric activator fructose 2,6-bisphosphate. Because of its proto-oncogenic character, the PFK-2/FBPase-2 of the PFKFB3 gene is assumed to play a critical role in tumorigenesis. The hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3) plays a crucial role in the progression of cancerous cells by enabling their glycolytic pathways even under severe hypoxic conditions.

Full Name
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
References
  • Kessler R, et al. (2008) 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB3) is up-regulated in high-grade astrocytomas. J Neurooncol. 86(3):257-64.
  • Yalcin A, et al. (2009) Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J Biol Chem. 284(36):24223-32.
  • Atsumi T, et al. (2002) High expression of inducible 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 262(20): 5881-7.
  • Kim SG, et al. (2006) Crystal structure of the hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3): a possible new target for cancer therapy. J Biol Chem. 281(5): 2939-44.
  • info info
    添加购物车成功! 添加购物车失败!