PFDN5 cDNA ORF Clone, Human, N-His tag

Cat: HG15442-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PFDN5 Reagents
CRO Services
Product recommended

All PFDN5 Reagents
PFDN5 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Human prefoldin subunit 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFDN5 cDNA ORF Clone, Human, N-His tag Alternative Names
MM-1 cDNA ORF Clone, Human;MM1 cDNA ORF Clone, Human;PFD5 cDNA ORF Clone, Human
PFDN5 Background Information
Full Name
prefoldin subunit 5

PFDN5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PFDN5 cDNA ORF Clone in Cloning Vector, Mouse MG53911-U
PFDN5 cDNA ORF Clone, Mouse, untagged MG53911-UT
PFDN5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53911-ACGLN
PFDN5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53911-ACG
PFDN5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53911-ANG
PFDN5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53911-ACR
PFDN5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53911-ANR
PFDN5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53911-CF
PFDN5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53911-NF
PFDN5 cDNA ORF Clone, Mouse, C-His tag MG53911-CH
PFDN5 cDNA ORF Clone, Mouse, N-His tag MG53911-NH
PFDN5 cDNA ORF Clone, Mouse, C-HA tag MG53911-CY
PFDN5 cDNA ORF Clone, Mouse, N-HA tag MG53911-NY
PFDN5 cDNA ORF Clone, Mouse, C-Myc tag MG53911-CM
PFDN5 cDNA ORF Clone, Mouse, N-Myc tag MG53911-NM

PFDN5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PFDN5 cDNA ORF Clone in Cloning Vector, Human HG15442-G
PFDN5 cDNA ORF Clone, Human, untagged HG15442-UT
PFDN5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15442-ACGLN
PFDN5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15442-ACG
PFDN5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15442-ANG
PFDN5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15442-ACR
PFDN5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15442-ANR
PFDN5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15442-CF
PFDN5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15442-NF
PFDN5 cDNA ORF Clone, Human, C-His tag HG15442-CH
PFDN5 cDNA ORF Clone, Human, C-HA tag HG15442-CY
PFDN5 cDNA ORF Clone, Human, N-HA tag HG15442-NY
PFDN5 cDNA ORF Clone, Human, C-Myc tag HG15442-CM
PFDN5 cDNA ORF Clone, Human, N-Myc tag HG15442-NM
PFDN5 qPCR Primer Pairs, Human HP104066
info info
添加购物车成功! 添加购物车失败!