Quick Order

Text Size:AAA

Human PFDN4 / PFD4 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PFDN4 cDNA Clone Product Information
NCBI RefSeq:BC010953
RefSeq ORF Size:405bp
cDNA Description:Full length Clone DNA of Homo sapiens prefoldin subunit 4 with C terminal His tag.
Gene Synonym:C1, PFD4, PFDN4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

References
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • Size / Price
    Catalog: HG14144-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"